sqlite3 -batch /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db "SELECT count(DISTINCT username) FROM sample2bioinformatician;"
count(DISTINCT username) ------------------------ 26
cd /shared/projects/2314_medbioinfo/hui/MedBioinfo23
pwd
/shared/projects/2314_medbioinfo/hui/MedBioinfo23
mkdir analyses/blastn & cd analyses/blastn
[1] 53695 bash: cd: analyses/blastn: No such file or directory
cd analyses/blastn
pwd
/shared/projects/2314_medbioinfo/hui/MedBioinfo23
module load blast
makeblastdb --help
USAGE
makeblastdb [-h] [-help] [-in input_file] [-input_type type]
-dbtype molecule_type [-title database_title] [-parse_seqids]
[-hash_index] [-mask_data mask_data_files] [-mask_id mask_algo_ids]
[-mask_desc mask_algo_descriptions] [-gi_mask]
[-gi_mask_name gi_based_mask_names] [-out database_name]
[-blastdb_version version] [-max_file_sz number_of_bytes]
[-logfile File_Name] [-taxid TaxID] [-taxid_map TaxIDMapFile] [-version]
DESCRIPTION
Application to create BLAST databases, version 2.12.0+
Use '-help' to print detailed descriptions of command line arguments
========================================================================
Error: Unknown argument: "-help"
Error: (CArgException::eInvalidArg) Unknown argument: "-help"
cd MedBioinfo23
pwd
/shared/projects/2314_medbioinfo/hui/MedBioinfo23
mkdir ../data/blast_db
pwd
/shared/projects/2314_medbioinfo/hui/MedBioinfo23
cd MedBioinfo23
zcat /shared/projects/2314_medbioinfo/refseq/viral.genomic.fna.gz | makeblastdb -dbtype nucl -title Refseq_viral_genome -out data/blast_db/refseq_viral_genomic/
Building a new DB, current time: 05/29/2023 11:28:39 New DB name: /shared/ifbstor1/projects/2314_medbioinfo/hui/MedBioinfo23/data/blast_db/refseq_viral_genomic New DB title: Refseq_viral_genome Sequence type: Nucleotide Keep MBits: T Maximum file size: 1000000000B Adding sequences from FASTA; added 14813 sequences in 7.82641 seconds.
blastdbcmd -info -db data/blast_db/refseq_viral_genomic
Database: Refseq_viral_genome 14,813 sequences; 469,589,088 total bases Date: May 29, 2023 11:28 AM Longest sequence: 2,473,870 bases BLASTDB Version: 5 Volumes: /shared/ifbstor1/projects/2314_medbioinfo/hui/MedBioinfo23/data/blast_db/refseq_viral_genomic
blastn -help
USAGE
blastn [-h] [-help] [-import_search_strategy filename]
[-export_search_strategy filename] [-task task_name] [-db database_name]
[-dbsize num_letters] [-gilist filename] [-seqidlist filename]
[-negative_gilist filename] [-negative_seqidlist filename]
[-taxids taxids] [-negative_taxids taxids] [-taxidlist filename]
[-negative_taxidlist filename] [-entrez_query entrez_query]
[-db_soft_mask filtering_algorithm] [-db_hard_mask filtering_algorithm]
[-subject subject_input_file] [-subject_loc range] [-query input_file]
[-out output_file] [-evalue evalue] [-word_size int_value]
[-gapopen open_penalty] [-gapextend extend_penalty]
[-perc_identity float_value] [-qcov_hsp_perc float_value]
[-max_hsps int_value] [-xdrop_ungap float_value] [-xdrop_gap float_value]
[-xdrop_gap_final float_value] [-searchsp int_value]
[-sum_stats bool_value] [-penalty penalty] [-reward reward] [-no_greedy]
[-min_raw_gapped_score int_value] [-template_type type]
[-template_length int_value] [-dust DUST_options]
[-filtering_db filtering_database]
[-window_masker_taxid window_masker_taxid]
[-window_masker_db window_masker_db] [-soft_masking soft_masking]
[-ungapped] [-culling_limit int_value] [-best_hit_overhang float_value]
[-best_hit_score_edge float_value] [-subject_besthit]
[-window_size int_value] [-off_diagonal_range int_value]
[-use_index boolean] [-index_name string] [-lcase_masking]
[-query_loc range] [-strand strand] [-parse_deflines] [-outfmt format]
[-show_gis] [-num_descriptions int_value] [-num_alignments int_value]
[-line_length line_length] [-html] [-sorthits sort_hits]
[-sorthsps sort_hsps] [-max_target_seqs num_sequences]
[-num_threads int_value] [-mt_mode int_value] [-remote] [-version]
DESCRIPTION
Nucleotide-Nucleotide BLAST 2.12.0+
OPTIONAL ARGUMENTS
-h
Print USAGE and DESCRIPTION; ignore all other parameters
-help
Print USAGE, DESCRIPTION and ARGUMENTS; ignore all other parameters
-version
Print version number; ignore other arguments
*** Input query options
-query <File_In>
Input file name
Default = `-'
-query_loc <String>
Location on the query sequence in 1-based offsets (Format: start-stop)
-strand <String, `both', `minus', `plus'>
Query strand(s) to search against database/subject
Default = `both'
*** General search options
-task <String, Permissible values: 'blastn' 'blastn-short' 'dc-megablast'
'megablast' 'rmblastn' >
Task to execute
Default = `megablast'
-db <String>
BLAST database name
* Incompatible with: subject, subject_loc
-out <File_Out>
Output file name
Default = `-'
-evalue <Real>
Expectation value (E) threshold for saving hits
Default = `10'
-word_size <Integer, >=4>
Word size for wordfinder algorithm (length of best perfect match)
-gapopen <Integer>
Cost to open a gap
-gapextend <Integer>
Cost to extend a gap
-penalty <Integer, <=0>
Penalty for a nucleotide mismatch
-reward <Integer, >=0>
Reward for a nucleotide match
-use_index <Boolean>
Use MegaBLAST database index
Default = `false'
-index_name <String>
MegaBLAST database index name (deprecated; use only for old style indices)
*** BLAST-2-Sequences options
-subject <File_In>
Subject sequence(s) to search
* Incompatible with: db, gilist, seqidlist, negative_gilist,
negative_seqidlist, taxids, taxidlist, negative_taxids, negative_taxidlist,
db_soft_mask, db_hard_mask
-subject_loc <String>
Location on the subject sequence in 1-based offsets (Format: start-stop)
* Incompatible with: db, gilist, seqidlist, negative_gilist,
negative_seqidlist, taxids, taxidlist, negative_taxids, negative_taxidlist,
db_soft_mask, db_hard_mask, remote
*** Formatting options
-outfmt <String>
alignment view options:
0 = Pairwise,
1 = Query-anchored showing identities,
2 = Query-anchored no identities,
3 = Flat query-anchored showing identities,
4 = Flat query-anchored no identities,
5 = BLAST XML,
6 = Tabular,
7 = Tabular with comment lines,
8 = Seqalign (Text ASN.1),
9 = Seqalign (Binary ASN.1),
10 = Comma-separated values,
11 = BLAST archive (ASN.1),
12 = Seqalign (JSON),
13 = Multiple-file BLAST JSON,
14 = Multiple-file BLAST XML2,
15 = Single-file BLAST JSON,
16 = Single-file BLAST XML2,
17 = Sequence Alignment/Map (SAM),
18 = Organism Report
Options 6, 7, 10 and 17 can be additionally configured to produce
a custom format specified by space delimited format specifiers,
or in the case of options 6, 7, and 10, by a token specified
by the delim keyword. E.g.: "17 delim=@ qacc sacc score".
The delim keyword must appear after the numeric output format
specification.
The supported format specifiers for options 6, 7 and 10 are:
qseqid means Query Seq-id
qgi means Query GI
qacc means Query accesion
qaccver means Query accesion.version
qlen means Query sequence length
sseqid means Subject Seq-id
sallseqid means All subject Seq-id(s), separated by a ';'
sgi means Subject GI
sallgi means All subject GIs
sacc means Subject accession
saccver means Subject accession.version
sallacc means All subject accessions
slen means Subject sequence length
qstart means Start of alignment in query
qend means End of alignment in query
sstart means Start of alignment in subject
send means End of alignment in subject
qseq means Aligned part of query sequence
sseq means Aligned part of subject sequence
evalue means Expect value
bitscore means Bit score
score means Raw score
length means Alignment length
pident means Percentage of identical matches
nident means Number of identical matches
mismatch means Number of mismatches
positive means Number of positive-scoring matches
gapopen means Number of gap openings
gaps means Total number of gaps
ppos means Percentage of positive-scoring matches
frames means Query and subject frames separated by a '/'
qframe means Query frame
sframe means Subject frame
btop means Blast traceback operations (BTOP)
staxid means Subject Taxonomy ID
ssciname means Subject Scientific Name
scomname means Subject Common Name
sblastname means Subject Blast Name
sskingdom means Subject Super Kingdom
staxids means unique Subject Taxonomy ID(s), separated by a ';'
(in numerical order)
sscinames means unique Subject Scientific Name(s), separated by a ';'
scomnames means unique Subject Common Name(s), separated by a ';'
sblastnames means unique Subject Blast Name(s), separated by a ';'
(in alphabetical order)
sskingdoms means unique Subject Super Kingdom(s), separated by a ';'
(in alphabetical order)
stitle means Subject Title
salltitles means All Subject Title(s), separated by a '<>'
sstrand means Subject Strand
qcovs means Query Coverage Per Subject
qcovhsp means Query Coverage Per HSP
qcovus means Query Coverage Per Unique Subject (blastn only)
When not provided, the default value is:
'qaccver saccver pident length mismatch gapopen qstart qend sstart send
evalue bitscore', which is equivalent to the keyword 'std'
The supported format specifier for option 17 is:
SQ means Include Sequence Data
SR means Subject as Reference Seq
Default = `0'
-show_gis
Show NCBI GIs in deflines?
-num_descriptions <Integer, >=0>
Number of database sequences to show one-line descriptions for
Not applicable for outfmt > 4
Default = `500'
* Incompatible with: max_target_seqs
-num_alignments <Integer, >=0>
Number of database sequences to show alignments for
Default = `250'
* Incompatible with: max_target_seqs
-line_length <Integer, >=1>
Line length for formatting alignments
Not applicable for outfmt > 4
Default = `60'
-html
Produce HTML output?
-sorthits <Integer, (>=0 and =<4)>
Sorting option for hits:
alignment view options:
0 = Sort by evalue,
1 = Sort by bit score,
2 = Sort by total score,
3 = Sort by percent identity,
4 = Sort by query coverage
Not applicable for outfmt > 4
-sorthsps <Integer, (>=0 and =<4)>
Sorting option for hps:
0 = Sort by hsp evalue,
1 = Sort by hsp score,
2 = Sort by hsp query start,
3 = Sort by hsp percent identity,
4 = Sort by hsp subject start
Not applicable for outfmt != 0
*** Query filtering options
-dust <String>
Filter query sequence with DUST (Format: 'yes', 'level window linker', or
'no' to disable)
Default = `20 64 1'
-filtering_db <String>
BLAST database containing filtering elements (i.e.: repeats)
-window_masker_taxid <Integer>
Enable WindowMasker filtering using a Taxonomic ID
-window_masker_db <String>
Enable WindowMasker filtering using this repeats database.
-soft_masking <Boolean>
Apply filtering locations as soft masks
Default = `true'
-lcase_masking
Use lower case filtering in query and subject sequence(s)?
*** Restrict search or results
-gilist <String>
Restrict search of database to list of GIs
* Incompatible with: seqidlist, taxids, taxidlist, negative_gilist,
negative_seqidlist, negative_taxids, negative_taxidlist, remote, subject,
subject_loc
-seqidlist <String>
Restrict search of database to list of SeqIDs
* Incompatible with: gilist, taxids, taxidlist, negative_gilist,
negative_seqidlist, negative_taxids, negative_taxidlist, remote, subject,
subject_loc
-negative_gilist <String>
Restrict search of database to everything except the specified GIs
* Incompatible with: gilist, seqidlist, taxids, taxidlist,
negative_seqidlist, negative_taxids, negative_taxidlist, remote, subject,
subject_loc
-negative_seqidlist <String>
Restrict search of database to everything except the specified SeqIDs
* Incompatible with: gilist, seqidlist, taxids, taxidlist,
negative_gilist, negative_taxids, negative_taxidlist, remote, subject,
subject_loc
-taxids <String>
Restrict search of database to include only the specified taxonomy IDs
(multiple IDs delimited by ',')
* Incompatible with: gilist, seqidlist, taxidlist, negative_gilist,
negative_seqidlist, negative_taxids, negative_taxidlist, remote, subject,
subject_loc
-negative_taxids <String>
Restrict search of database to everything except the specified taxonomy IDs
(multiple IDs delimited by ',')
* Incompatible with: gilist, seqidlist, taxids, taxidlist,
negative_gilist, negative_seqidlist, negative_taxidlist, remote, subject,
subject_loc
-taxidlist <String>
Restrict search of database to include only the specified taxonomy IDs
* Incompatible with: gilist, seqidlist, taxids, negative_gilist,
negative_seqidlist, negative_taxids, negative_taxidlist, remote, subject,
subject_loc
-negative_taxidlist <String>
Restrict search of database to everything except the specified taxonomy IDs
* Incompatible with: gilist, seqidlist, taxids, taxidlist,
negative_gilist, negative_seqidlist, negative_taxids, remote, subject,
subject_loc
-entrez_query <String>
Restrict search with the given Entrez query
* Requires: remote
-db_soft_mask <String>
Filtering algorithm ID to apply to the BLAST database as soft masking
* Incompatible with: db_hard_mask, subject, subject_loc
-db_hard_mask <String>
Filtering algorithm ID to apply to the BLAST database as hard masking
* Incompatible with: db_soft_mask, subject, subject_loc
-perc_identity <Real, 0..100>
Percent identity
-qcov_hsp_perc <Real, 0..100>
Percent query coverage per hsp
-max_hsps <Integer, >=1>
Set maximum number of HSPs per subject sequence to save for each query
-culling_limit <Integer, >=0>
If the query range of a hit is enveloped by that of at least this many
higher-scoring hits, delete the hit
* Incompatible with: best_hit_overhang, best_hit_score_edge
-best_hit_overhang <Real, (>0 and <0.5)>
Best Hit algorithm overhang value (recommended value: 0.1)
* Incompatible with: culling_limit
-best_hit_score_edge <Real, (>0 and <0.5)>
Best Hit algorithm score edge value (recommended value: 0.1)
* Incompatible with: culling_limit
-subject_besthit
Turn on best hit per subject sequence
-max_target_seqs <Integer, >=1>
Maximum number of aligned sequences to keep
(value of 5 or more is recommended)
Default = `500'
* Incompatible with: num_descriptions, num_alignments
*** Discontiguous MegaBLAST options
-template_type <String, `coding', `coding_and_optimal', `optimal'>
Discontiguous MegaBLAST template type
* Requires: template_length
-template_length <Integer, Permissible values: '16' '18' '21' >
Discontiguous MegaBLAST template length
* Requires: template_type
*** Statistical options
-dbsize <Int8>
Effective length of the database
-searchsp <Int8, >=0>
Effective length of the search space
-sum_stats <Boolean>
Use sum statistics
*** Search strategy options
-import_search_strategy <File_In>
Search strategy to use
* Incompatible with: export_search_strategy
-export_search_strategy <File_Out>
File name to record the search strategy used
* Incompatible with: import_search_strategy
*** Extension options
-xdrop_ungap <Real>
X-dropoff value (in bits) for ungapped extensions
-xdrop_gap <Real>
X-dropoff value (in bits) for preliminary gapped extensions
-xdrop_gap_final <Real>
X-dropoff value (in bits) for final gapped alignment
-no_greedy
Use non-greedy dynamic programming extension
-min_raw_gapped_score <Integer>
Minimum raw gapped score to keep an alignment in the preliminary gapped and
traceback stages
-ungapped
Perform ungapped alignment only?
-window_size <Integer, >=0>
Multiple hits window size, use 0 to specify 1-hit algorithm
-off_diagonal_range <Integer, >=0>
Number of off-diagonals to search for the 2nd hit, use 0 to turn off
Default = `0'
*** Miscellaneous options
-parse_deflines
Should the query and subject defline(s) be parsed?
-num_threads <Integer, >=1>
Number of threads (CPUs) to use in the BLAST search
Default = `1'
* Incompatible with: remote
-mt_mode <Integer, (>=0 and =<1)>
Multi-thread mode to use in BLAST search:
0 (auto) split by database
1 split by queries
Default = `0'
* Requires: num_threads
-remote
Execute search remotely?
* Incompatible with: gilist, seqidlist, taxids, taxidlist,
negative_gilist, negative_seqidlist, negative_taxids, negative_taxidlist,
subject_loc, num_threads
pwd
/shared/projects/2314_medbioinfo/hui/MedBioinfo23
module load seqkit
seqkit stats data/merged_pairs/*.fastq.gz
file format type num_seqs sum_len min_len avg_len max_len data/merged_pairs/ERR6913156.flash.extendedFrags.fastq.gz FASTQ DNA 22,291 3,262,339 35 146.4 292 data/merged_pairs/ERR6913156.flash.notCombined_1.fastq.gz FASTQ DNA 1,867 280,159 35 150.1 151 data/merged_pairs/ERR6913156.flash.notCombined_2.fastq.gz FASTQ DNA 1,867 280,159 35 150.1 151 data/merged_pairs/ERR6913158.flash.extendedFrags.fastq.gz FASTQ DNA 690,579 99,890,771 35 144.6 292 data/merged_pairs/ERR6913158.flash.notCombined_1.fastq.gz FASTQ DNA 65,028 9,760,304 35 150.1 151 data/merged_pairs/ERR6913158.flash.notCombined_2.fastq.gz FASTQ DNA 65,028 9,759,131 35 150.1 151 data/merged_pairs/ERR6913168.flash.extendedFrags.fastq.gz FASTQ DNA 63,620 9,531,276 35 149.8 292 data/merged_pairs/ERR6913168.flash.notCombined_1.fastq.gz FASTQ DNA 7,711 1,158,275 35 150.2 151 data/merged_pairs/ERR6913168.flash.notCombined_2.fastq.gz FASTQ DNA 7,711 1,158,282 35 150.2 151 data/merged_pairs/ERR6913169.flash.extendedFrags.fastq.gz FASTQ DNA 76,719 11,359,696 35 148.1 292 data/merged_pairs/ERR6913169.flash.notCombined_1.fastq.gz FASTQ DNA 6,522 978,887 35 150.1 151 data/merged_pairs/ERR6913169.flash.notCombined_2.fastq.gz FASTQ DNA 6,522 978,965 35 150.1 151 data/merged_pairs/ERR6913252.flash.extendedFrags.fastq.gz FASTQ DNA 8,980 1,182,504 35 131.7 292 data/merged_pairs/ERR6913252.flash.notCombined_1.fastq.gz FASTQ DNA 987 144,954 35 146.9 151 data/merged_pairs/ERR6913252.flash.notCombined_2.fastq.gz FASTQ DNA 987 144,936 35 146.8 151 data/merged_pairs/ERR6913254.flash.extendedFrags.fastq.gz FASTQ DNA 47,673 5,033,825 35 105.6 292 data/merged_pairs/ERR6913254.flash.notCombined_1.fastq.gz FASTQ DNA 2,277 238,041 35 104.5 151 data/merged_pairs/ERR6913254.flash.notCombined_2.fastq.gz FASTQ DNA 2,277 237,989 35 104.5 151 data/merged_pairs/ERR6913264.flash.extendedFrags.fastq.gz FASTQ DNA 9,930 1,186,470 35 119.5 292 data/merged_pairs/ERR6913264.flash.notCombined_1.fastq.gz FASTQ DNA 761 83,623 35 109.9 151 data/merged_pairs/ERR6913264.flash.notCombined_2.fastq.gz FASTQ DNA 761 83,740 35 110 151 data/merged_pairs/ERR6913265.flash.extendedFrags.fastq.gz FASTQ DNA 16,592 1,679,747 35 101.2 292 data/merged_pairs/ERR6913265.flash.notCombined_1.fastq.gz FASTQ DNA 855 81,853 35 95.7 151 data/merged_pairs/ERR6913265.flash.notCombined_2.fastq.gz FASTQ DNA 855 81,840 35 95.7 151
seqkit fq2fa data/merged_pairs/ERR6913158.flash.extendedFrags.fastq.gz > data/merged_pairs/ERR6913156.flash.extendedFrags.fna
seqkit range --range 1:101 data/merged_pairs/ERR6913156.flash.extendedFrags.fna > data/merged_pairs/ERR6913156.flash.extendedFrags.100.fna
seqkit range --range 101:1101 data/merged_pairs/ERR6913156.flash.extendedFrags.fna > data/merged_pairs/ERR6913156.flash.extendedFrags.1000.fna
seqkit range --range 1101:11101 data/merged_pairs/ERR6913156.flash.extendedFrags.fna > data/merged_pairs/ERR6913156.flash.extendedFrags.10000.fna
pwd
/shared/projects/2314_medbioinfo/hui/MedBioinfo23
cat ./analyses/huiyu_run_accession.txt
ERR6913156 ERR6913158 ERR6913169 ERR6913264 ERR6913265 ERR6913168 ERR6913252 ERR6913254
seqkit stats data/merged_pairs/ERR6913156.*.fna
file format type num_seqs sum_len min_len avg_len max_len data/merged_pairs/ERR6913156.flash.extendedFrags.10000.fna FASTA DNA 10,001 1,446,399 36 144.6 292 data/merged_pairs/ERR6913156.flash.extendedFrags.1000.fna FASTA DNA 1,001 146,176 40 146 291 data/merged_pairs/ERR6913156.flash.extendedFrags.100.fna FASTA DNA 101 14,125 62 139.9 285 data/merged_pairs/ERR6913156.flash.extendedFrags.fna FASTA DNA 690,579 99,890,771 35 144.6 292
cp scripts/generic_sbatch_array.sh scripts/fastq_subsamples_blastn_vs_viral_refseq_sbatch.sh
make dir for output before the sbatch
mkdir analyses/blastn/output
squeue -u huiyu
JOBID PARTITION NAME USER ST TIME NODES NODELIST(REASON)
33578763 fast jupyter huiyu R 1:26:03 1 cpu-node-3
pwd
/shared/projects/2314_medbioinfo/hui/MedBioinfo23
sbatch scripts/fastq_subsamples_blastn_vs_viral_refseq_sbatch.sh
Submitted batch job 33580193
sacct -j 33580193
JobID JobName Partition Account AllocCPUS State ExitCode ------------ ---------- ---------- ---------- ---------- ---------- -------- 33580193 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33580193.ba+ batch 2314_medb+ 1 COMPLETED 0:0 33580193.0 bastn_100 2314_medb+ 1 COMPLETED 0:0 33580193.1 bastn_1000 2314_medb+ 1 COMPLETED 0:0 33580193.2 bastn_100+ 2314_medb+ 1 COMPLETED 0:0
sbatch scripts/fastq_subsamples_blastn_vs_viral_refseq_sbatch.sh
Submitted batch job 33580520
sacct -j 33580520
JobID JobName Partition Account AllocCPUS State ExitCode ------------ ---------- ---------- ---------- ---------- ---------- -------- 33580520 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33580520.ba+ batch 2314_medb+ 1 COMPLETED 0:0 33580520.0 bastn_100 2314_medb+ 1 COMPLETED 0:0 33580520.1 bastn_1000 2314_medb+ 1 COMPLETED 0:0 33580520.2 bastn_100+ 2314_medb+ 1 COMPLETED 0:0
cat analyses/blastn/fastq_subsample_blastn_vs_refseq_viral_100.tsv
grep -B 4 -A20 "significant alignments" analyses/blastn/fastq_subsample_blastn_vs_refseq_viral_10000.blast
Query= ERR6913158.917.1 917 length=94
Length=94
Score E
Sequences producing significant alignments: (Bits) Value
NC_054146.1 Ralstonia phage phiRSP, complete genome 63.9 2e-09
>NC_054146.1 Ralstonia phage phiRSP, complete genome
Length=44526
Score = 63.9 bits (34), Expect = 2e-09
Identities = 34/34 (100%), Gaps = 0/34 (0%)
Strand=Plus/Minus
Query 32 CCACCAGCGCCCGCGAAAAGAGCCAGCTCATTCA 65
||||||||||||||||||||||||||||||||||
Sbjct 13689 CCACCAGCGCCCGCGAAAAGAGCCAGCTCATTCA 13656
Lambda K H
1.33 0.621 1.12
--
Query= ERR6913158.1572.1 1572 length=119
Length=119
Score E
Sequences producing significant alignments: (Bits) Value
NC_031904.1 Flavobacterium phage Fpv3, complete genome 215 7e-55
NC_031912.1 Flavobacterium phage Fpv20, complete genome 215 7e-55
NC_031931.1 Flavobacterium phage Fpv2, complete genome 215 7e-55
NC_031914.1 Flavobacterium phage Fpv1, complete genome 215 7e-55
NC_041872.1 Flavobacterium phage FpV4, complete genome 215 7e-55
>NC_031904.1 Flavobacterium phage Fpv3, complete genome
Length=88421
Score = 215 bits (116), Expect = 7e-55
Identities = 118/119 (99%), Gaps = 0/119 (0%)
Strand=Plus/Plus
Query 1 GGACCAAGTAATTCAAAATTAAATACCATTATTTCTCTCAATAACATTAATAATTTTGTA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 75200 GGACCAAGTAATTCAAAATTAAATACCATTATTTCTCTCAATAACATTAATAATTTTGTA 75259
Query 61 AACTTCTGCTATATAGTAAGGATAATAAATAATTTCCTTTATTTCTTCATCTGTTATCA 119
--
Query= ERR6913158.1708.1 1708 length=151
Length=217
Score E
Sequences producing significant alignments: (Bits) Value
NC_011589.1 Stenotrophomonas phage S1, complete genome 95.3 2e-18
>NC_011589.1 Stenotrophomonas phage S1, complete genome
Length=40287
Score = 95.3 bits (51), Expect = 2e-18
Identities = 118/151 (78%), Gaps = 1/151 (1%)
Strand=Plus/Plus
Query 61 CGCGGCTACCACATCAACTGCCTGTACTACCAGTTTGGCCTGGGCCCCCGCTGGCTAGAC 120
||||||||| ||||||||||||||||||||||||||||||||| || |||||||| |||
Sbjct 4317 CGCGGCTACACCATCAACTGCCTGTACTACCAGTTTGGCCTGGGTCCACGCTGGCTGGAC 4376
Query 121 CTTATCGACACCTGGCGCGATGTGCAAAACGAACCCGCCCGCCTCAAAACCTTTTTAAAT 180
|| | | |||| || | ||| ||| || || |||||| ||||| | ||
Sbjct 4377 CTGGTAAAAGAGTGGCTGGAGGCGCAGGGCGATCCAGCTTCCCTCAAGACCTTCGTGAAC 4436
Query 181 GACCGCCTGGCCGAGCCGTGGGAAGACGCCG 211
--
Query= ERR6913158.2013.1 2013 length=151
Length=177
Score E
Sequences producing significant alignments: (Bits) Value
NC_042116.1 Yersinia phage fHe-Yen9-04 genome assembly, complete ... 137 2e-31
NC_041878.1 Pectobacterium phage CBB, complete genome 126 5e-28
NC_019401.1 Cronobacter phage vB_CsaM_GAP32, complete genome 126 5e-28
>NC_042116.1 Yersinia phage fHe-Yen9-04 genome assembly, complete
genome: monopartite
Length=354378
Score = 137 bits (74), Expect = 2e-31
Identities = 102/116 (88%), Gaps = 0/116 (0%)
Strand=Plus/Plus
Query 1 GTAACTCGTGATATTAACATGCGTATTAAAGCACTAGCATATGGTGTTGAAGTACAAGAT 60
||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||
Sbjct 58242 GTAACTCGTGATATTAATATGCGAATTAAAGCACTAGCATATGGTGTTGAAGTTCAAGAT 58301
Query 61 TATCGTCACGATGTAACAATCGAAGACTCAGACCTAATCCACACAGGCCACCATGC 116
|||||||||||| ||||||| ||||| || || | || || ||||| || |||||
--
Query= ERR6913158.2287.1 2287 length=114
Length=114
Score E
Sequences producing significant alignments: (Bits) Value
NC_048844.1 Flavobacterium phage vB_FspS_tooticki6-1, complete ge... 178 8e-44
NC_048837.1 Flavobacterium phage vB_FspS_mumin9-1, complete genome 178 8e-44
NC_048831.1 Flavobacterium phage vB_FspS_filifjonk9-1, complete g... 178 8e-44
>NC_048844.1 Flavobacterium phage vB_FspS_tooticki6-1, complete
genome
Length=36912
Score = 178 bits (96), Expect = 8e-44
Identities = 106/111 (95%), Gaps = 0/111 (0%)
Strand=Plus/Minus
Query 4 TAACGTTATCGGGCTTGGCGAAGTGGCTGAACCCGAACTTAAATAGAATTACTAAACTTT 63
||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||
Sbjct 3728 TAACGTTTTCGGGCTTGGCGAAGTGGCTGAACCTGAAGCTAAATAGAATTACTAAACTTA 3669
Query 64 AAAATTAAAAACGAATGATTGATAGAATTACTGAACAGCCATTTTGCCAAA 114
|||||||||||||||||||||||||||||||||||||||||||||||||||
--
Query= ERR6913158.3302.1 3302 length=139
Length=139
Score E
Sequences producing significant alignments: (Bits) Value
NC_048844.1 Flavobacterium phage vB_FspS_tooticki6-1, complete ge... 185 6e-46
NC_048837.1 Flavobacterium phage vB_FspS_mumin9-1, complete genome 182 8e-45
NC_048831.1 Flavobacterium phage vB_FspS_filifjonk9-1, complete g... 182 8e-45
>NC_048844.1 Flavobacterium phage vB_FspS_tooticki6-1, complete
genome
Length=36912
Score = 185 bits (100), Expect = 6e-46
Identities = 123/134 (92%), Gaps = 1/134 (1%)
Strand=Plus/Plus
Query 6 ACCTTCGCCAAGCCCGAAAACGTTAGTGGCAATACTCCGAAGCCCTCCGAACAGCGACAT 65
||| |||| ||||| |||||||||||||||||||||| ||||||| ||||| |||||||
Sbjct 2842 ACC-TCGCAAAGCCGCAAAACGTTAGTGGCAATACTCCAAAGCCCTACGAACTGCGACAT 2900
Query 66 CGTAATATTGTTTTTCCTTTTCAATACCAATTGATTTGCGATTTAATTTAATGCAAGCAA 125
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
--
Query= ERR6913158.3387.1 3387 length=106
Length=106
Score E
Sequences producing significant alignments: (Bits) Value
NC_048832.1 Flavobacterium phage vB_FspS_hattifnatt9-1, complete ... 161 8e-39
>NC_048832.1 Flavobacterium phage vB_FspS_hattifnatt9-1, complete
genome
Length=39262
Score = 161 bits (87), Expect = 8e-39
Identities = 93/96 (97%), Gaps = 0/96 (0%)
Strand=Plus/Plus
Query 11 TTCTATTTAAGTTTGTGAGAAGCCCTACCTATAACAGCACATAGGCAATATGGCGGGTTC 70
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 3010 TTCTGTTTAAATTTGTGAGAAGCCCTACCTATAACAGCACATAGGCAATATGGCGGGTTC 3069
Query 71 TCGGTTAATATTAAGTTCAGTTTTTCAAATCAAGTT 106
||||||||||||||||||||||||| ||||||||||
Sbjct 3070 TCGGTTAATATTAAGTTCAGTTTTTTAAATCAAGTT 3105
--
Query= ERR6913158.4294.1 4294 length=77
Length=77
Score E
Sequences producing significant alignments: (Bits) Value
NC_054651.1 Escherichia phage C1, complete genome 67.6 1e-10
>NC_054651.1 Escherichia phage C1, complete genome
Length=46667
Score = 67.6 bits (36), Expect = 1e-10
Identities = 44/48 (92%), Gaps = 0/48 (0%)
Strand=Plus/Minus
Query 22 AACGCTGTCCCACTTATTCTGTGTCGTCCCATACGGCAAATCGCACAA 69
|||||| |||||||| || ||||||||||||||||||||||||||||
Sbjct 16880 AACGCTATCCCACTTGTTGCGTGTCGTCCCATACGGCAAATCGCACAA 16833
Lambda K H
1.33 0.621 1.12
--
Query= ERR6913158.5690.1 5690 length=149
Length=279
Score E
Sequences producing significant alignments: (Bits) Value
NC_055868.1 CrAssphage cr50_1, complete genome 54.7 4e-06
>NC_055868.1 CrAssphage cr50_1, complete genome
Length=98826
Score = 54.7 bits (29), Expect = 4e-06
Identities = 29/29 (100%), Gaps = 0/29 (0%)
Strand=Plus/Plus
Query 67 GTTCAACGACTATCCCGAAAGGGAGTACA 95
|||||||||||||||||||||||||||||
Sbjct 55541 GTTCAACGACTATCCCGAAAGGGAGTACA 55569
Lambda K H
1.33 0.621 1.12
--
Query= ERR6913158.6257.1 6257 length=106
Length=106
Score E
Sequences producing significant alignments: (Bits) Value
NC_005260.1 Aeromonas phage Aeh1, complete genome 73.1 4e-12
NC_014636.1 Aeromonas phage phiAS5, complete genome 71.3 1e-11
>NC_005260.1 Aeromonas phage Aeh1, complete genome
Length=233234
Score = 73.1 bits (39), Expect = 4e-12
Identities = 53/60 (88%), Gaps = 0/60 (0%)
Strand=Plus/Plus
Query 30 GTGTCTCGATCGCACTTCTGCAACAGACCACCACCCATACCGAACGCGATGTTGTCAACA 89
||||| || ||||| ||||||||||||||||||||||||||||| || | ||| ||||||
Sbjct 79845 GTGTCACGGTCGCATTTCTGCAACAGACCACCACCCATACCGAAAGCTACGTTTTCAACA 79904
>NC_014636.1 Aeromonas phage phiAS5, complete genome
Length=225268
--
Query= ERR6913158.6351.1 6351 length=106
Length=106
Score E
Sequences producing significant alignments: (Bits) Value
NC_005260.1 Aeromonas phage Aeh1, complete genome 73.1 4e-12
NC_014636.1 Aeromonas phage phiAS5, complete genome 71.3 1e-11
>NC_005260.1 Aeromonas phage Aeh1, complete genome
Length=233234
Score = 73.1 bits (39), Expect = 4e-12
Identities = 53/60 (88%), Gaps = 0/60 (0%)
Strand=Plus/Plus
Query 30 GTGTCTCGATCGCACTTCTGCAACAGACCACCACCCATACCGAACGCGATGTTGTCAACA 89
||||| || ||||| ||||||||||||||||||||||||||||| || | ||| ||||||
Sbjct 79845 GTGTCACGGTCGCATTTCTGCAACAGACCACCACCCATACCGAAAGCTACGTTTTCAACA 79904
>NC_014636.1 Aeromonas phage phiAS5, complete genome
Length=225268
--
Query= ERR6913158.6994.1 6994 length=150
Length=217
Score E
Sequences producing significant alignments: (Bits) Value
NC_055783.1 Escherichia phage vB_EcoM_005, complete genome 54.7 3e-06
>NC_055783.1 Escherichia phage vB_EcoM_005, complete genome
Length=155101
Score = 54.7 bits (29), Expect = 3e-06
Identities = 31/32 (97%), Gaps = 0/32 (0%)
Strand=Plus/Minus
Query 149 ACACCCGCATGATTTTGTTTTTCCTGTTTTTA 180
||| ||||||||||||||||||||||||||||
Sbjct 75994 ACAGCCGCATGATTTTGTTTTTCCTGTTTTTA 75963
Lambda K H
1.33 0.621 1.12
--
Query= ERR6913158.8370.1 8370 length=141
Length=141
Score E
Sequences producing significant alignments: (Bits) Value
NC_029021.1 Enterobacteria phage JenK1, complete genome 54.7 2e-06
>NC_029021.1 Enterobacteria phage JenK1, complete genome
Length=60747
Score = 54.7 bits (29), Expect = 2e-06
Identities = 35/38 (92%), Gaps = 0/38 (0%)
Strand=Plus/Minus
Query 7 ATCACCCCAACGAATATTTCCAGGATTGCAATTACGGA 44
|||||||||||||||||||||||||||| ||| ||||
Sbjct 59682 ATCACCCCAACGAATATTTCCAGGATTGTTATTCCGGA 59645
Lambda K H
1.33 0.621 1.12
--
Query= ERR6913158.8734.1 8734 length=93
Length=93
Score E
Sequences producing significant alignments: (Bits) Value
NC_031129.1 Salmonella phage SJ46, complete genome 100 1e-20
>NC_031129.1 Salmonella phage SJ46, complete genome
Length=103445
Score = 100 bits (54), Expect = 1e-20
Identities = 76/87 (87%), Gaps = 0/87 (0%)
Strand=Plus/Minus
Query 7 GTGTTCTTCAACCGGCTGGGCTAAATCCGCGACAGCAGCTTTGAGCAGCAGCGCTACCGG 66
|||||||||||||| || || ||||| | || | ||||| ||||||||||||||||||
Sbjct 58806 GTGTTCTTCAACCGCCTTGGGGAAATCAGGGATCGGAGCTTCGAGCAGCAGCGCTACCGG 58747
Query 67 GCCAGCGGCCTCAATCTGGTGACGGCG 93
|||||||||||||| ||||||||||||
Sbjct 58746 GCCAGCGGCCTCAACCTGGTGACGGCG 58720
--
Query= ERR6913158.11319.1 11319 length=150
Length=209
Score E
Sequences producing significant alignments: (Bits) Value
NC_049451.1 Klebsiella phage ST147-VIM1phi7.1, complete genome 220 3e-56
NC_049453.1 Klebsiella phage ST13-OXA48phi12.1, complete genome 215 1e-54
>NC_049451.1 Klebsiella phage ST147-VIM1phi7.1, complete genome
Length=34141
Score = 220 bits (119), Expect = 3e-56
Identities = 165/188 (88%), Gaps = 0/188 (0%)
Strand=Plus/Plus
Query 13 TCGGCCAGCTCTTCCGGGGTCGGCTCGCGGCCGATCTCGTGCAGCATCTGGCGGCTGGTG 72
|| |||||||||||||||||||| || ||||| ||||| ||||||||||| ||| | |
Sbjct 29146 TCAGCCAGCTCTTCCGGGGTCGGTTCACGGCCCATCTCCTGCAGCATCTGACGGGAGATA 29205
Query 73 CGGACGATCTTGTTGATCGTCTCGATCATGTGCACCGGGATGCGGATGGTGCGCGCCTGG 132
||| || ||||||||| ||||| ||||| |||||||| || |||||||||||||||||
Sbjct 29206 CGGTTGAGCTTGTTGATAGTCTCAATCATATGCACCGGAATACGGATGGTGCGCGCCTGA 29265
--
Query= ERR6913158.11581.1 11581 length=150
Length=246
Score E
Sequences producing significant alignments: (Bits) Value
NC_041917.1 Serratia phage BF, complete genome 150 4e-35
NC_019401.1 Cronobacter phage vB_CsaM_GAP32, complete genome 139 1e-31
>NC_041917.1 Serratia phage BF, complete genome
Length=357154
Score = 150 bits (81), Expect = 4e-35
Identities = 159/197 (81%), Gaps = 4/197 (2%)
Strand=Plus/Plus
Query 38 CTAAAGCGGCAGGTGCTTGGGTACAAGATCCAGTTCTAGGGCTAGTGGATTACCTTGGAT 97
||||||| |||||||| ||||| ||||||||||| || || || | || | | | || |
Sbjct 189472 CTAAAGCAGCAGGTGCATGGGTTCAAGATCCAGTACTTGGTTTAATCGACTTCTTAGGCT 189531
Query 98 GTACTGACTTCAACTCCCTATACCCAACTGTACTACGTGCATTAGGTATGAGTACTGAAT 157
|| ||||||||||| ||||| ||||| || ||||||||||||||||||||||||||||
Sbjct 189532 GTGTAGACTTCAACTCACTATATCCAACAGTTCTACGTGCATTAGGTATGAGTACTGAAT 189591
--
Query= ERR6913158.11703.1 11703 length=151
Length=207
Score E
Sequences producing significant alignments: (Bits) Value
NC_015265.1 Burkholderia phage KS5, complete genome 339 7e-92
>NC_015265.1 Burkholderia phage KS5, complete genome
Length=37236
Score = 339 bits (183), Expect = 7e-92
Identities = 199/207 (96%), Gaps = 0/207 (0%)
Strand=Plus/Plus
Query 1 CGACGTTATTTAACCAGCCGGTGCCGGTATTAAAGCAGGCTTTCGCGGGAAGCGATATTC 60
|||||||||||||||||| || ||| ||||||||||||||||||||| ||||||||||||
Sbjct 25146 CGACGTTATTTAACCAGCAGGCGCCAGTATTAAAGCAGGCTTTCGCGAGAAGCGATATTC 25205
Query 61 CGTCCGAGTTATGTCCCATGTCCGCCTAACCTAGAACGAGGGAATGTCTGGACGTAGTTT 120
|||||||||||||||||||||||||||||||| ||||||||||||| |||||||| ||||
Sbjct 25206 CGTCCGAGTTATGTCCCATGTCCGCCTAACCTGGAACGAGGGAATGGCTGGACGTGGTTT 25265
Query 121 TGGCTATTGCGATAAAGATTCGAGGACGATTTCCGCGATCCGATCGACATCGACATCGGC 180
cp scripts/fastq_subsamples_blastn_vs_viral_refseq_sbatch.sh scripts/fastq_full_blastn_vs_viral_refseq_sbatch.sh
ls data/merged_pairs/
ERR6913156.flash.extendedFrags.10000.fna ERR6913156.flash.extendedFrags.1000.fna ERR6913156.flash.extendedFrags.100.fna ERR6913156.flash.extendedFrags.fastq.gz ERR6913156.flash.extendedFrags.fna ERR6913156.flash.hist ERR6913156.flash.histogram ERR6913156.flash.notCombined_1.fastq.gz ERR6913156.flash.notCombined_2.fastq.gz ERR6913158.flash.extendedFrags.fastq.gz ERR6913158.flash.hist ERR6913158.flash.histogram ERR6913158.flash.notCombined_1.fastq.gz ERR6913158.flash.notCombined_2.fastq.gz ERR6913168.flash.extendedFrags.fastq.gz ERR6913168.flash.hist ERR6913168.flash.histogram ERR6913168.flash.notCombined_1.fastq.gz ERR6913168.flash.notCombined_2.fastq.gz ERR6913169.flash.extendedFrags.fastq.gz ERR6913169.flash.hist ERR6913169.flash.histogram ERR6913169.flash.notCombined_1.fastq.gz ERR6913169.flash.notCombined_2.fastq.gz ERR6913252.flash.extendedFrags.fastq.gz ERR6913252.flash.hist ERR6913252.flash.histogram ERR6913252.flash.notCombined_1.fastq.gz ERR6913252.flash.notCombined_2.fastq.gz ERR6913254.flash.extendedFrags.fastq.gz ERR6913254.flash.hist ERR6913254.flash.histogram ERR6913254.flash.notCombined_1.fastq.gz ERR6913254.flash.notCombined_2.fastq.gz ERR6913264.flash.extendedFrags.fastq.gz ERR6913264.flash.hist ERR6913264.flash.histogram ERR6913264.flash.notCombined_1.fastq.gz ERR6913264.flash.notCombined_2.fastq.gz ERR6913265.flash.extendedFrags.fastq.gz ERR6913265.flash.hist ERR6913265.flash.histogram ERR6913265.flash.notCombined_1.fastq.gz ERR6913265.flash.notCombined_2.fastq.gz
seqkit stats data/merged_pairs/*.fasta
file format type num_seqs sum_len min_len avg_len max_len data/merged_pairs/ERR6913156.flash.extendedFrags.fasta FASTA DNA 22,291 3,262,339 35 146.4 292 data/merged_pairs/ERR6913158.flash.extendedFrags.fasta FASTA DNA 690,579 99,890,771 35 144.6 292 data/merged_pairs/ERR6913168.flash.extendedFrags.fasta FASTA DNA 63,620 9,531,276 35 149.8 292 data/merged_pairs/ERR6913169.flash.extendedFrags.fasta FASTA DNA 76,719 11,359,696 35 148.1 292 data/merged_pairs/ERR6913252.flash.extendedFrags.fasta FASTA DNA 8,980 1,182,504 35 131.7 292 data/merged_pairs/ERR6913254.flash.extendedFrags.fasta FASTA DNA 47,673 5,033,825 35 105.6 292 data/merged_pairs/ERR6913264.flash.extendedFrags.fasta FASTA DNA 9,930 1,186,470 35 119.5 292 data/merged_pairs/ERR6913265.flash.extendedFrags.fasta FASTA DNA 16,592 1,679,747 35 101.2 292
sbatch scripts/fastq_full_blastn_vs_viral_refseq_sbatch.sh
Submitted batch job 33582512
sacct -j 33582512
JobID JobName Partition Account AllocCPUS State ExitCode ------------ ---------- ---------- ---------- ---------- ---------- -------- 33582512_1 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33582512_1.+ batch 2314_medb+ 1 COMPLETED 0:0 33582512_1.0 ERR6913156 2314_medb+ 1 COMPLETED 0:0 33582512_2 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33582512_2.+ batch 2314_medb+ 1 COMPLETED 0:0 33582512_2.0 ERR6913158 2314_medb+ 1 COMPLETED 0:0 33582512_3 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33582512_3.+ batch 2314_medb+ 1 COMPLETED 0:0 33582512_3.0 ERR6913169 2314_medb+ 1 COMPLETED 0:0 33582512_4 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33582512_4.+ batch 2314_medb+ 1 COMPLETED 0:0 33582512_4.0 ERR6913264 2314_medb+ 1 COMPLETED 0:0 33582512_5 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33582512_5.+ batch 2314_medb+ 1 COMPLETED 0:0 33582512_5.0 ERR6913265 2314_medb+ 1 COMPLETED 0:0 33582512_6 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33582512_6.+ batch 2314_medb+ 1 COMPLETED 0:0 33582512_6.0 ERR6913168 2314_medb+ 1 COMPLETED 0:0 33582512_7 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33582512_7.+ batch 2314_medb+ 1 COMPLETED 0:0 33582512_7.0 ERR6913252 2314_medb+ 1 COMPLETED 0:0 33582512_8 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33582512_8.+ batch 2314_medb+ 1 COMPLETED 0:0 33582512_8.0 ERR6913254 2314_medb+ 1 COMPLETED 0:0
sacct --format=JobName%20,ReqCPUS,ReqMem,State,ExitCode,elapsed,MaxRSS -j 33582512
JobName ReqCPUS ReqMem State ExitCode Elapsed MaxRSS
-------------------- -------- ---------- ---------- -------- ---------- ----------
MedBioinfo 1 2Gn COMPLETED 0:0 00:00:11
batch 1 2Gn COMPLETED 0:0 00:00:11 1344K
ERR6913156 1 2Gn COMPLETED 0:0 00:00:09 960K
MedBioinfo 1 2Gn COMPLETED 0:0 00:02:26
batch 1 2Gn COMPLETED 0:0 00:02:26 7964K
ERR6913158 1 2Gn COMPLETED 0:0 00:02:26 478000K
MedBioinfo 1 2Gn COMPLETED 0:0 00:00:21
batch 1 2Gn COMPLETED 0:0 00:00:21 1336K
ERR6913169 1 2Gn COMPLETED 0:0 00:00:19 956K
MedBioinfo 1 2Gn COMPLETED 0:0 00:00:05
batch 1 2Gn COMPLETED 0:0 00:00:05 1332K
ERR6913264 1 2Gn COMPLETED 0:0 00:00:05 964K
MedBioinfo 1 2Gn COMPLETED 0:0 00:00:08
batch 1 2Gn COMPLETED 0:0 00:00:08 1328K
ERR6913265 1 2Gn COMPLETED 0:0 00:00:06 960K
MedBioinfo 1 2Gn COMPLETED 0:0 00:00:18
batch 1 2Gn COMPLETED 0:0 00:00:18 1344K
ERR6913168 1 2Gn COMPLETED 0:0 00:00:17 964K
MedBioinfo 1 2Gn COMPLETED 0:0 00:00:04
batch 1 2Gn COMPLETED 0:0 00:00:04 1332K
ERR6913252 1 2Gn COMPLETED 0:0 00:00:03 956K
MedBioinfo 1 2Gn COMPLETED 0:0 00:00:11
batch 1 2Gn COMPLETED 0:0 00:00:11 1336K
ERR6913254 1 2Gn COMPLETED 0:0 00:00:09 972K
wc -l analyses/blastn/*.out
548 analyses/blastn/ERR6913156_blastn_vs_viral.out
2808 analyses/blastn/ERR6913158_blastn_vs_viral.out
344 analyses/blastn/ERR6913168_blastn_vs_viral.out
383 analyses/blastn/ERR6913169_blastn_vs_viral.out
197 analyses/blastn/ERR6913252_blastn_vs_viral.out
488 analyses/blastn/ERR6913254_blastn_vs_viral.out
45 analyses/blastn/ERR6913264_blastn_vs_viral.out
133 analyses/blastn/ERR6913265_blastn_vs_viral.out
4946 total
using a one-liner with cut sort uniq sort piped in this order, can you give the list of the viral genomes hit by your BLASTn with the number of hits (sorted by increasing number of hits) ?
cut --help
Usage: cut OPTION... [FILE]...
Print selected parts of lines from each FILE to standard output.
Mandatory arguments to long options are mandatory for short options too.
-b, --bytes=LIST select only these bytes
-c, --characters=LIST select only these characters
-d, --delimiter=DELIM use DELIM instead of TAB for field delimiter
-f, --fields=LIST select only these fields; also print any line
that contains no delimiter character, unless
the -s option is specified
-n with -b: don't split multibyte characters
--complement complement the set of selected bytes, characters
or fields
-s, --only-delimited do not print lines not containing delimiters
--output-delimiter=STRING use STRING as the output delimiter
the default is to use the input delimiter
--help display this help and exit
--version output version information and exit
Use one, and only one of -b, -c or -f. Each LIST is made up of one
range, or many ranges separated by commas. Selected input is written
in the same order that it is read, and is written exactly once.
Each range is one of:
N N'th byte, character or field, counted from 1
N- from N'th byte, character or field, to end of line
N-M from N'th to M'th (included) byte, character or field
-M from first to M'th (included) byte, character or field
With no FILE, or when FILE is -, read standard input.
GNU coreutils online help: <http://www.gnu.org/software/coreutils/>
For complete documentation, run: info coreutils 'cut invocation'
cat analyses/blastn/*.out| cut -f2 | sort | uniq -c | sort -n -r | head -n5
149 NC_048831.1
122 NC_019401.1
115 NC_041917.1
104 NC_025447.1
98 NC_048833.1
sort: write failed: standard output: Broken pipe
sort: write error
for file in analyses/blastn/*.out
do
echo "$file"
cut -f2 $file | sort | uniq -c | sort -n -r | head -n5
done
analyses/blastn/ERR6913156_blastn_vs_viral.out
26 NC_001416.1
22 NC_019723.1
19 NC_049955.1
19 NC_049952.1
19 NC_049951.1
analyses/blastn/ERR6913158_blastn_vs_viral.out
112 NC_048831.1
97 NC_019401.1
95 NC_041917.1
91 NC_025447.1
77 NC_027364.1
analyses/blastn/ERR6913168_blastn_vs_viral.out
33 NC_027981.1
33 NC_004456.1
31 NC_019722.1
13 NC_019401.1
11 NC_048831.1
analyses/blastn/ERR6913169_blastn_vs_viral.out
57 NC_027981.1
54 NC_019722.1
52 NC_004456.1
16 NC_048831.1
11 NC_048842.1
analyses/blastn/ERR6913252_blastn_vs_viral.out
76 NC_006577.2
10 NC_003045.1
5 NC_006213.1
4 NC_012936.1
3 NC_046954.1
analyses/blastn/ERR6913254_blastn_vs_viral.out
35 NC_001405.1
35 AC_000008.1
35 AC_000007.1
32 AC_000017.1
12 NC_008168.1
analyses/blastn/ERR6913264_blastn_vs_viral.out
4 NC_001405.1
4 AC_000017.1
4 AC_000008.1
4 AC_000007.1
3 NC_047752.1
analyses/blastn/ERR6913265_blastn_vs_viral.out
6 NC_045512.2
4 NC_022089.1
3 NC_049464.1
3 NC_008168.1
3 NC_001405.1
cd /shared/projects/2314_medbioinfo/hui/MedBioinfo23
pwd
/shared/projects/2314_medbioinfo/hui/MedBioinfo23
cp scripts/fastq_full_blastn_vs_viral_refseq_sbatch.sh scripts/fastq_blastn_vs_nt_refseq_sbatch.sh
mkdir analyses/fastq_subsample_blastn_vs_NT
module load seqkit
seqkit range --range 200:210 data/merged_pairs/ERR6913158.flash.extendedFrags.fasta > data/merged_pairs/ERR6913158.flash.extendedFrags.10.fasta
sbatch scripts/fastq_blastn_vs_nt_refseq_sbatch.sh
Submitted batch job 33590753
sacct -j 33590753
JobID JobName Partition Account AllocCPUS State ExitCode ------------ ---------- ---------- ---------- ---------- ---------- -------- 33590753 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33590753.ba+ batch 2314_medb+ 1 COMPLETED 0:0 33590753.0 ERR691315+ 2314_medb+ 1 COMPLETED 0:0
sacct --user huiyu
JobID JobName Partition Account AllocCPUS State ExitCode ------------ ---------- ---------- ---------- ---------- ---------- -------- 33586683 jupyter fast 2314_medb+ 1 CANCELLED+ 0:0 33586683.ba+ batch 2314_medb+ 1 CANCELLED 0:15 33586683.0 batchspaw+ 2314_medb+ 1 COMPLETED 0:0 33590656_1 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33590656_1.+ batch 2314_medb+ 1 COMPLETED 0:0 33590656_1.0 ERR691315+ 2314_medb+ 1 COMPLETED 0:0 33590656_2 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33590656_2.+ batch 2314_medb+ 1 COMPLETED 0:0 33590656_2.0 ERR691315+ 2314_medb+ 1 COMPLETED 0:0 33590656_3 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33590656_3.+ batch 2314_medb+ 1 COMPLETED 0:0 33590656_3.0 ERR691315+ 2314_medb+ 1 COMPLETED 0:0 33590656_4 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33590656_4.+ batch 2314_medb+ 1 COMPLETED 0:0 33590656_4.0 ERR691315+ 2314_medb+ 1 COMPLETED 0:0 33590656_5 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33590656_5.+ batch 2314_medb+ 1 COMPLETED 0:0 33590656_5.0 ERR691315+ 2314_medb+ 1 COMPLETED 0:0 33590656_6 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33590656_6.+ batch 2314_medb+ 1 COMPLETED 0:0 33590656_6.0 ERR691315+ 2314_medb+ 1 COMPLETED 0:0 33590656_7 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33590656_7.+ batch 2314_medb+ 1 COMPLETED 0:0 33590656_7.0 ERR691315+ 2314_medb+ 1 COMPLETED 0:0 33590656_8 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33590656_8.+ batch 2314_medb+ 1 COMPLETED 0:0 33590656_8.0 ERR691315+ 2314_medb+ 1 COMPLETED 0:0 33590730 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33590730.ba+ batch 2314_medb+ 1 COMPLETED 0:0 33590730.0 ERR691315+ 2314_medb+ 1 COMPLETED 0:0 33590753 MedBioinfo fast 2314_medb+ 1 COMPLETED 0:0 33590753.ba+ batch 2314_medb+ 1 COMPLETED 0:0 33590753.0 ERR691315+ 2314_medb+ 1 COMPLETED 0:0 33590823 jupyter fast 2314_medb+ 1 RUNNING 0:0 33590823.ba+ batch 2314_medb+ 1 RUNNING 0:0 33590823.0 batchspaw+ 2314_medb+ 1 RUNNING 0:0
sacct --format=JobName%20,ReqCPUS,ReqMem,State,ExitCode,elapsed,MaxRSS -j 33590753
JobName ReqCPUS ReqMem State ExitCode Elapsed MaxRSS
-------------------- -------- ---------- ---------- -------- ---------- ----------
MedBioinfo 1 70Gn COMPLETED 0:0 00:11:36
batch 1 70Gn COMPLETED 0:0 00:11:36 7884K
ERR6913158_bastn_10+ 1 70Gn COMPLETED 0:0 00:11:35 19648676K
pwd
/shared/projects/2314_medbioinfo/hui/MedBioinfo23
#select the
sacct -P --format=JobID%15,JobName%18,ReqCPUS,ReqMem,Timelimit,State,ExitCode,Start,elapsedRAW,CPUTimeRAW,MaxRSS,NodeList -S 2023-05-29 -j 33582512\
| grep ERR > blastn_full_FASTQ_vs_viral_sbatch_array.sacct
cat blastn_full_FASTQ_vs_viral_sbatch_array.sacct
33582512_1.0|ERR6913156|1|2Gn||COMPLETED|0:0|2023-05-29T14:56:17|9|9|960K|cpu-node-88 33582512_2.0|ERR6913158|1|2Gn||COMPLETED|0:0|2023-05-29T14:56:15|146|146|478000K|cpu-node-88 33582512_3.0|ERR6913169|1|2Gn||COMPLETED|0:0|2023-05-29T14:56:17|19|19|956K|cpu-node-88 33582512_4.0|ERR6913264|1|2Gn||COMPLETED|0:0|2023-05-29T14:56:15|5|5|964K|cpu-node-88 33582512_5.0|ERR6913265|1|2Gn||COMPLETED|0:0|2023-05-29T14:56:17|6|6|960K|cpu-node-88 33582512_6.0|ERR6913168|1|2Gn||COMPLETED|0:0|2023-05-29T14:56:16|17|17|964K|cpu-node-88 33582512_7.0|ERR6913252|1|2Gn||COMPLETED|0:0|2023-05-29T14:56:16|3|3|956K|cpu-node-88 33582512_8.0|ERR6913254|1|2Gn||COMPLETED|0:0|2023-05-29T14:56:17|9|9|972K|cpu-node-88
sqlite3 -batch -separator "|" /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db \
".import ./blastn_full_FASTQ_vs_viral_sbatch_array.sacct blastn_viral_resources_used"
sqlite3 -box -batch /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db "select * from blastn_viral_resources_used where JobID like '33582512%';"
┌──────────────┬────────────┬─────────┬────────┬───────────┬───────────┬──────────┬─────────────────────┬────────────┬────────────┬─────────┬─────────────┐ │ JobID │ JobName │ ReqCPUS │ ReqMem │ Timelimit │ State │ ExitCode │ Start │ ElapsedRAW │ CPUTimeRAW │ MaxRSS │ NodeList │ ├──────────────┼────────────┼─────────┼────────┼───────────┼───────────┼──────────┼─────────────────────┼────────────┼────────────┼─────────┼─────────────┤ │ 33582512_1.0 │ ERR6913156 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:56:17 │ 9 │ 9 │ 960K │ cpu-node-88 │ │ 33582512_2.0 │ ERR6913158 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:56:15 │ 146 │ 146 │ 478000K │ cpu-node-88 │ │ 33582512_3.0 │ ERR6913169 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:56:17 │ 19 │ 19 │ 956K │ cpu-node-88 │ │ 33582512_4.0 │ ERR6913264 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:56:15 │ 5 │ 5 │ 964K │ cpu-node-88 │ │ 33582512_5.0 │ ERR6913265 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:56:17 │ 6 │ 6 │ 960K │ cpu-node-88 │ │ 33582512_6.0 │ ERR6913168 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:56:16 │ 17 │ 17 │ 964K │ cpu-node-88 │ │ 33582512_7.0 │ ERR6913252 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:56:16 │ 3 │ 3 │ 956K │ cpu-node-88 │ │ 33582512_8.0 │ ERR6913254 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:56:17 │ 9 │ 9 │ 972K │ cpu-node-88 │ └──────────────┴────────────┴─────────┴────────┴───────────┴───────────┴──────────┴─────────────────────┴────────────┴────────────┴─────────┴─────────────┘
sqlite3 -box -batch /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db "select * from blastn_viral_resources_used;"
┌───────────────┬──────────────┬─────────┬────────┬───────────┬───────────┬──────────┬─────────────────────┬────────────┬────────────┬─────────┬─────────────┐ │ JobID │ JobName │ ReqCPUS │ ReqMem │ Timelimit │ State │ ExitCode │ Start │ ElapsedRAW │ CPUTimeRAW │ MaxRSS │ NodeList │ ├───────────────┼──────────────┼─────────┼────────┼───────────┼───────────┼──────────┼─────────────────────┼────────────┼────────────┼─────────┼─────────────┤ │ 33575030_1.1 │ ERR6913174 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-28T12:03:56 │ 20 │ 480 │ 1252K │ cpu-node-15 │ │ 33575030_2.1 │ ERR6913270 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-28T12:04:09 │ 19 │ 456 │ 1232K │ cpu-node-27 │ │ 33575030_3.1 │ ERR6913175 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-28T12:04:17 │ 30 │ 720 │ 236340K │ cpu-node-29 │ │ 33575030_4.1 │ ERR6913271 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-28T12:04:18 │ 109 │ 2616 │ 578788K │ cpu-node-33 │ │ 33575030_5.1 │ ERR6913176 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-28T12:04:18 │ 89 │ 2136 │ 764940K │ cpu-node-40 │ │ 33575030_6.1 │ ERR6913272 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-28T12:04:16 │ 10 │ 240 │ 1240K │ cpu-node-43 │ │ 33575030_7.1 │ ERR6913177 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-28T12:04:20 │ 120 │ 2880 │ 593872K │ cpu-node-67 │ │ 33575030_8.1 │ ERR6913273 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-28T12:04:18 │ 3 │ 72 │ 1152K │ cpu-node-88 │ │ 33575030_9.1 │ ERR6913178 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-28T12:04:19 │ 62 │ 1488 │ 567752K │ cpu-node-1 │ │ 33575030_10.1 │ ERR6913274 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-28T12:04:17 │ 5 │ 120 │ 1244K │ cpu-node-1 │ │ 33583170_2.1 │ ERR6913141 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:22:03 │ 278 │ 278 │ 459676K │ cpu-node-88 │ │ 33583170_3.1 │ ERR6913142 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:57 │ 129 │ 129 │ 443964K │ cpu-node-88 │ │ 33583170_4.1 │ ERR6913143 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:58 │ 166 │ 166 │ 438488K │ cpu-node-88 │ │ 33583170_5.1 │ ERR6913144 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:22:01 │ 236 │ 236 │ 438768K │ cpu-node-88 │ │ 33583170_6.1 │ ERR6913240 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:22:05 │ 224 │ 224 │ 461388K │ cpu-node-88 │ │ 33583170_7.1 │ ERR6913201 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:50 │ 27 │ 27 │ 960K │ cpu-node-88 │ │ 33583170_8.1 │ ERR6913237 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:22:07 │ 302 │ 302 │ 467960K │ cpu-node-88 │ │ 33583170_9.1 │ ERR6913238 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:22:10 │ 341 │ 341 │ 460300K │ cpu-node-88 │ │ 33583170_10.1 │ ERR6913239 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:22:07 │ 338 │ 338 │ 465116K │ cpu-node-88 │ │ 33581928_1.1 │ ERR6913298 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:37:15 │ 1 │ 1 │ 952K │ cpu-node-88 │ │ 33581928_2.1 │ ERR6913299 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:37:15 │ 1 │ 1 │ 956K │ cpu-node-88 │ │ 33581928_3.1 │ ERR6913222 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:37:15 │ 1 │ 1 │ 964K │ cpu-node-88 │ │ 33581928_4.1 │ ERR6913295 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:37:15 │ 1 │ 1 │ 964K │ cpu-node-88 │ │ 33581928_5.1 │ ERR6913126 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:37:15 │ 1 │ 1 │ 960K │ cpu-node-88 │ │ 33581928_6.1 │ ERR6913324 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:37:15 │ 1 │ 1 │ 960K │ cpu-node-88 │ │ 33581928_7.1 │ ERR6913327 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:37:15 │ 1 │ 1 │ 964K │ cpu-node-88 │ │ 33581928_8.1 │ ERR6913328 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:37:15 │ 1 │ 1 │ 964K │ cpu-node-88 │ │ 33581582_1.1 │ ERR6913183 │ 1 │ 4Gn │ │ FAILED │ 1:0 │ 2023-05-29T14:28:44 │ 1 │ 1 │ 1048K │ cpu-node-33 │ │ 33581582_2.1 │ ERR6913279 │ 1 │ 4Gn │ │ FAILED │ 1:0 │ 2023-05-29T14:28:37 │ 0 │ 0 │ 1028K │ cpu-node-67 │ │ 33581582_3.1 │ ERR6913184 │ 1 │ 4Gn │ │ FAILED │ 1:0 │ 2023-05-29T14:28:37 │ 0 │ 0 │ 1216K │ cpu-node-67 │ │ 33581582_4.1 │ ERR6913280 │ 1 │ 4Gn │ │ FAILED │ 1:0 │ 2023-05-29T14:28:37 │ 1 │ 1 │ 1048K │ cpu-node-67 │ │ 33581582_5.1 │ ERR6913185 │ 1 │ 4Gn │ │ FAILED │ 1:0 │ 2023-05-29T14:28:36 │ 0 │ 0 │ 1048K │ cpu-node-67 │ │ 33581582_6.1 │ ERR6913281 │ 1 │ 4Gn │ │ FAILED │ 1:0 │ 2023-05-29T14:28:37 │ 0 │ 0 │ 1224K │ cpu-node-67 │ │ 33581582_7.1 │ ERR6913186 │ 1 │ 4Gn │ │ FAILED │ 1:0 │ 2023-05-29T14:28:37 │ 0 │ 0 │ 1224K │ cpu-node-67 │ │ 33581582_8.1 │ ERR6913282 │ 1 │ 4Gn │ │ FAILED │ 1:0 │ 2023-05-29T14:28:35 │ 1 │ 1 │ 1052K │ cpu-node-67 │ │ 33583140_1.1 │ ERR6913174_1 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:20 │ 20 │ 20 │ 968K │ cpu-node-88 │ │ 33583140_2.1 │ ERR6913177_2 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:35 │ 280 │ 280 │ 539936K │ cpu-node-88 │ │ 33583140_3.1 │ ERR6913272_1 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:20 │ 18 │ 18 │ 952K │ cpu-node-88 │ │ 33583140_4.1 │ ERR6913174_2 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:21 │ 30 │ 30 │ 142920K │ cpu-node-88 │ │ 33583140_5.1 │ ERR6913178_1 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:25 │ 109 │ 109 │ 446800K │ cpu-node-88 │ │ 33583140_6.1 │ ERR6913272_2 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:20 │ 18 │ 18 │ 964K │ cpu-node-88 │ │ 33583140_7.1 │ ERR6913175_1 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:22 │ 54 │ 54 │ 555992K │ cpu-node-88 │ │ 33583140_8.1 │ ERR6913178_2 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:26 │ 148 │ 148 │ 551640K │ cpu-node-88 │ │ 33583140_9.1 │ ERR6913273_1 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:19 │ 4 │ 4 │ 960K │ cpu-node-88 │ │ 33583140_10.1 │ ERR6913175_2 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:22 │ 56 │ 56 │ 259892K │ cpu-node-88 │ │ 33583140_11.1 │ ERR6913270_1 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:21 │ 44 │ 44 │ 370220K │ cpu-node-88 │ │ 33583140_12.1 │ ERR6913273_2 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:19 │ 6 │ 6 │ 948K │ cpu-node-88 │ │ 33583140_13.1 │ ERR6913176_1 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:28 │ 201 │ 201 │ 549720K │ cpu-node-88 │ │ 33583140_14.1 │ ERR6913270_2 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:20 │ 30 │ 30 │ 143956K │ cpu-node-88 │ │ 33583140_15.1 │ ERR6913274_1 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:18 │ 9 │ 9 │ 956K │ cpu-node-88 │ │ 33583140_16.1 │ ERR6913176_2 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:30 │ 209 │ 209 │ 550120K │ cpu-node-88 │ │ 33583140_17.1 │ ERR6913271_1 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:29 │ 193 │ 193 │ 531104K │ cpu-node-88 │ │ 33583140_18.1 │ ERR6913274_2 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:18 │ 9 │ 9 │ 964K │ cpu-node-88 │ │ 33583140_19.1 │ ERR6913177_1 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:32 │ 197 │ 197 │ 538448K │ cpu-node-88 │ │ 33583140_20.1 │ ERR6913271_2 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:21:25 │ 182 │ 182 │ 531744K │ cpu-node-88 │ │ 33582344_1.1 │ ERR6913341 │ 12 │ 10Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:50:37 │ 466 │ 5592 │ 443556K │ cpu-node-64 │ │ 33582344_2.1 │ ERR6913345 │ 12 │ 10Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:50:20 │ 169 │ 2028 │ 568284K │ cpu-node-88 │ │ 33582344_3.1 │ ERR6913314 │ 12 │ 10Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:50:20 │ 131 │ 1572 │ 379576K │ cpu-node-33 │ │ 33582344_4.1 │ ERR6913316 │ 12 │ 10Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:50:17 │ 72 │ 864 │ 376496K │ cpu-node-33 │ │ 33582344_5.1 │ ERR6913312 │ 12 │ 10Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:50:18 │ 54 │ 648 │ 567088K │ cpu-node-67 │ │ 33582344_6.1 │ ERR6913315 │ 12 │ 10Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:50:17 │ 40 │ 480 │ 359192K │ cpu-node-67 │ │ 33582344_7.1 │ ERR6913343 │ 12 │ 10Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:50:22 │ 185 │ 2220 │ 422700K │ cpu-node-1 │ │ 33582344_8.1 │ ERR6913344 │ 12 │ 10Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:50:21 │ 117 │ 1404 │ 394624K │ cpu-node-1 │ │ 33582308_1.1 │ ERR6913148 │ 1 │ 25Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:48:20 │ 48 │ 48 │ 356980K │ cpu-node-33 │ │ 33582308_2.1 │ ERR6913244 │ 1 │ 25Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:48:30 │ 244 │ 244 │ 460200K │ cpu-node-33 │ │ 33582308_3.1 │ ERR6913149 │ 1 │ 25Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:48:25 │ 143 │ 143 │ 454356K │ cpu-node-67 │ │ 33582308_4.1 │ ERR6913245 │ 1 │ 25Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:48:33 │ 1533 │ 1533 │ 466764K │ cpu-node-46 │ │ 33582308_5.1 │ ERR6913150 │ 1 │ 25Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:48:25 │ 652 │ 652 │ 458780K │ cpu-node-46 │ │ 33582308_6.1 │ ERR6913246 │ 1 │ 25Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:48:35 │ 400 │ 400 │ 459320K │ cpu-node-42 │ │ 33582308_7.1 │ ERR6913151 │ 1 │ 25Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:48:20 │ 69 │ 69 │ 437176K │ cpu-node-42 │ │ 33582308_8.1 │ ERR6913247 │ 1 │ 25Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:48:29 │ 220 │ 220 │ 449156K │ cpu-node-43 │ │ 33582209_1.1 │ ERR6913114 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:45:37 │ 30 │ 60 │ 1232K │ cpu-node-1 │ │ 33582209_2.1 │ ERR6913123 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:45:38 │ 40 │ 80 │ 475980K │ cpu-node-67 │ │ 33582209_3.1 │ ERR6913124 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:45:37 │ 14 │ 28 │ 1220K │ cpu-node-67 │ │ 33582209_4.1 │ ERR6913155 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:45:36 │ 3 │ 6 │ 1232K │ cpu-node-67 │ │ 33582209_5.1 │ ERR6913251 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:45:35 │ 3 │ 6 │ 1228K │ cpu-node-67 │ │ 33582209_6.1 │ ERR6913219 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:45:38 │ 54 │ 108 │ 395628K │ cpu-node-88 │ │ 33582209_7.1 │ ERR6913210 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:45:37 │ 12 │ 24 │ 1144K │ cpu-node-88 │ │ 33582209_8.1 │ ERR6913220 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:45:35 │ 11 │ 22 │ 1144K │ cpu-node-88 │ │ 33582872_1.1 │ ERR6913131 │ 12 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:11:20 │ 95 │ 1140 │ 500132K │ cpu-node-88 │ │ 33582872_2.1 │ ERR6913132 │ 12 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:11:22 │ 89 │ 1068 │ 465368K │ cpu-node-15 │ │ 33582872_3.1 │ ERR6913133 │ 12 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:11:20 │ 64 │ 768 │ 506140K │ cpu-node-15 │ │ 33582872_4.1 │ ERR6913134 │ 12 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:11:19 │ 12 │ 144 │ 1224K │ cpu-node-33 │ │ 33582872_5.1 │ ERR6913227 │ 12 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:11:24 │ 212 │ 2544 │ 560744K │ cpu-node-33 │ │ 33582872_6.1 │ ERR6913229 │ 12 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:11:23 │ 143 │ 1716 │ 489888K │ cpu-node-67 │ │ 33582872_7.1 │ ERR6913104 │ 12 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:11:18 │ 33 │ 396 │ 432180K │ cpu-node-67 │ │ 33582872_8.1 │ ERR6913200 │ 12 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:11:22 │ 61 │ 732 │ 404852K │ cpu-node-25 │ │ 33582872_9.1 │ ERR6913230 │ 12 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:11:19 │ 34 │ 408 │ 186176K │ cpu-node-25 │ │ 33582872_10.1 │ ERR6913228 │ 12 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:11:22 │ 110 │ 1320 │ 422036K │ cpu-node-25 │ │ 33582902_1.1 │ ERR6913313 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:11:59 │ 280 │ 280 │ 549348K │ cpu-node-33 │ │ 33582902_2.1 │ ERR6913342 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:12:11 │ 464 │ 464 │ 473524K │ cpu-node-33 │ │ 33582902_3.1 │ ERR6913294 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:12:03 │ 309 │ 309 │ 536496K │ cpu-node-33 │ │ 33582902_4.1 │ ERR6913323 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:12:07 │ 357 │ 357 │ 549492K │ cpu-node-33 │ │ 33582902_5.1 │ ERR6913161 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:11:50 │ 11 │ 11 │ 1044K │ cpu-node-67 │ │ 33582902_6.1 │ ERR6913257 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:11:50 │ 9 │ 9 │ 1048K │ cpu-node-67 │ │ 33582902_7.1 │ ERR6913171 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:11:51 │ 31 │ 31 │ 248852K │ cpu-node-67 │ │ 33582902_8.1 │ ERR6913267 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:11:48 │ 12 │ 12 │ 1044K │ cpu-node-67 │ │ 33582668_1.1 │ ERR6913135 │ 24 │ 5Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:00:49 │ 79 │ 1896 │ 597748K │ cpu-node-15 │ │ 33582668_2.1 │ ERR6913231 │ 24 │ 5Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:00:52 │ 184 │ 4416 │ 630128K │ cpu-node-43 │ │ 33582668_3.1 │ ERR6913121 │ 24 │ 5Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:00:47 │ 10 │ 240 │ 1240K │ cpu-node-1 │ │ 33582668_4.1 │ ERR6913217 │ 24 │ 5Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:00:46 │ 16 │ 384 │ 1248K │ cpu-node-1 │ │ 33582668_5.1 │ ERR6913297 │ 24 │ 5Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:00:50 │ 110 │ 2640 │ 717952K │ cpu-node-25 │ │ 33582668_6.1 │ ERR6913326 │ 24 │ 5Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:00:51 │ 118 │ 2832 │ 720488K │ cpu-node-25 │ │ 33582668_7.1 │ ERR6913106 │ 24 │ 5Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:00:49 │ 68 │ 1632 │ 515412K │ cpu-node-27 │ │ 33582668_8.1 │ ERR6913202 │ 24 │ 5Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:00:49 │ 81 │ 1944 │ 587080K │ cpu-node-28 │ │ 33582512_1.0 │ ERR6913156 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:56:17 │ 9 │ 9 │ 960K │ cpu-node-88 │ │ 33582512_2.0 │ ERR6913158 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:56:15 │ 146 │ 146 │ 478000K │ cpu-node-88 │ │ 33582512_3.0 │ ERR6913169 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:56:17 │ 19 │ 19 │ 956K │ cpu-node-88 │ │ 33582512_4.0 │ ERR6913264 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:56:15 │ 5 │ 5 │ 964K │ cpu-node-88 │ │ 33582512_5.0 │ ERR6913265 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:56:17 │ 6 │ 6 │ 960K │ cpu-node-88 │ │ 33582512_6.0 │ ERR6913168 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:56:16 │ 17 │ 17 │ 964K │ cpu-node-88 │ │ 33582512_7.0 │ ERR6913252 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:56:16 │ 3 │ 3 │ 956K │ cpu-node-88 │ │ 33582512_8.0 │ ERR6913254 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:56:17 │ 9 │ 9 │ 972K │ cpu-node-88 │ │ 33583723_1.1 │ ERR6913103 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:01:28 │ 40 │ 80 │ 175240K │ cpu-node-41 │ │ 33583723_2.1 │ ERR6913128 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:01:33 │ 101 │ 202 │ 443260K │ cpu-node-1 │ │ 33583723_3.1 │ ERR6913199 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:01:28 │ 7 │ 14 │ 1224K │ cpu-node-1 │ │ 33583723_4.1 │ ERR6913224 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:01:36 │ 140 │ 280 │ 479524K │ cpu-node-1 │ │ 33583723_5.1 │ ERR6913115 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:01:29 │ 4 │ 8 │ 1228K │ cpu-node-1 │ │ 33583723_6.1 │ ERR6913211 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:01:29 │ 6 │ 12 │ 1232K │ cpu-node-1 │ │ 33583723_7.1 │ ERR6913117 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:01:28 │ 29 │ 58 │ 1224K │ cpu-node-1 │ │ 33583723_8.1 │ ERR6913213 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:01:29 │ 5 │ 10 │ 1060K │ cpu-node-1 │ │ 33583723_9.1 │ ERR6913111 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:01:28 │ 5 │ 10 │ 1220K │ cpu-node-33 │ │ 33583723_10.1 │ ERR6913207 │ 2 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:01:28 │ 3 │ 6 │ 1224K │ cpu-node-33 │ │ 33582427_1.1 │ ERR6913173 │ 1 │ 250Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:52:45 │ 3 │ 3 │ 1008K │ cpu-node-80 │ │ 33582427_2.1 │ ERR6913137 │ 1 │ 250Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:52:52 │ 129 │ 129 │ 455156K │ cpu-node-12 │ │ 33582427_3.1 │ ERR6913159 │ 1 │ 250Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:52:45 │ 3 │ 3 │ 1064K │ cpu-node-61 │ │ 33582427_4.1 │ ERR6913166 │ 1 │ 250Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:52:45 │ 12 │ 12 │ 1060K │ cpu-node-5 │ │ 33582427_5.1 │ ERR6913255 │ 1 │ 250Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:52:45 │ 2 │ 2 │ 1060K │ cpu-node-6 │ │ 33582427_6.1 │ ERR6913262 │ 1 │ 250Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:53:15 │ 3 │ 3 │ 1004K │ cpu-node-80 │ │ 33582427_7.1 │ ERR6913269 │ 1 │ 250Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:53:15 │ 4 │ 4 │ 1056K │ cpu-node-61 │ │ 33582427_8.1 │ ERR6913233 │ 1 │ 250Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:53:30 │ 253 │ 253 │ 475820K │ cpu-node-5 │ │ 33582771_2.1 │ ERR6913102 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:05:19 │ 0 │ 0 │ 968K │ cpu-node-88 │ │ 33582771_3.1 │ ERR6913189 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:05:25 │ 124 │ 124 │ 438384K │ cpu-node-88 │ │ 33582771_4.1 │ ERR6913285 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:05:40 │ 219 │ 219 │ 469788K │ cpu-node-38 │ │ 33582771_5.1 │ ERR6913187 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:05:21 │ 30 │ 30 │ 145756K │ cpu-node-38 │ │ 33582771_6.1 │ ERR6913283 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:05:20 │ 29 │ 29 │ 1052K │ cpu-node-36 │ │ 33582771_7.1 │ ERR6913284 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:05:30 │ 159 │ 159 │ 466296K │ cpu-node-36 │ │ 33582771_8.1 │ ERR6913188 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:05:28 │ 152 │ 152 │ 438412K │ cpu-node-37 │ │ 33581964_1.1 │ ERR6913179 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:25 │ 121 │ 121 │ 439764K │ cpu-node-1 │ │ 33581964_2.1 │ ERR6913180 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:31 │ 263 │ 263 │ 430200K │ cpu-node-1 │ │ 33581964_3.1 │ ERR6913181 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:30 │ 242 │ 242 │ 436824K │ cpu-node-1 │ │ 33581964_4.1 │ ERR6913182 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:28 │ 209 │ 209 │ 448832K │ cpu-node-1 │ │ 33581964_5.1 │ ERR6913276 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:36 │ 408 │ 408 │ 505756K │ cpu-node-33 │ │ 33581964_6.1 │ ERR6913278 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:35 │ 339 │ 339 │ 447052K │ cpu-node-33 │ │ 33581964_7.1 │ ERR6913101 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:22 │ 87 │ 87 │ 490192K │ cpu-node-33 │ │ 33581964_8.1 │ ERR6913197 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:22 │ 99 │ 99 │ 496332K │ cpu-node-33 │ │ 33581964_9.1 │ ERR6913275 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:20 │ 81 │ 81 │ 436940K │ cpu-node-33 │ │ 33581964_10.1 │ ERR6913277 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:28 │ 215 │ 215 │ 470340K │ cpu-node-67 │ │ 33584141_1.1 │ ERR6913170 │ 4 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:32:59 │ 2 │ 8 │ 1240K │ cpu-node-15 │ │ 33584141_2.1 │ ERR6913266 │ 4 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:32:59 │ 2 │ 8 │ 1236K │ cpu-node-67 │ │ 33584141_3.1 │ ERR6913109 │ 4 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:32:59 │ 4 │ 16 │ 1236K │ cpu-node-67 │ │ 33584141_4.1 │ ERR6913164 │ 4 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:32:59 │ 14 │ 56 │ 1244K │ cpu-node-67 │ │ 33584141_5.1 │ ERR6913172 │ 4 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:33:01 │ 57 │ 228 │ 502896K │ cpu-node-67 │ │ 33584141_6.1 │ ERR6913260 │ 4 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:32:59 │ 3 │ 12 │ 1240K │ cpu-node-67 │ │ 33584141_7.1 │ ERR6913268 │ 4 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:33:00 │ 20 │ 80 │ 1228K │ cpu-node-67 │ │ 33584141_8.1 │ ERR6913205 │ 4 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:33:00 │ 31 │ 124 │ 374956K │ cpu-node-44 │ │ 33582171_1.1 │ ERR6913191 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:44:35 │ 16 │ 384 │ 1252K │ cpu-node-15 │ │ 33582171_2.1 │ ERR6913193 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:44:36 │ 52 │ 1248 │ 214332K │ cpu-node-33 │ │ 33582171_3.1 │ ERR6913236 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:44:42 │ 220 │ 5280 │ 616116K │ cpu-node-43 │ │ 33582171_4.1 │ ERR6913291 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:44:41 │ 150 │ 3600 │ 569796K │ cpu-node-67 │ │ 33582171_5.1 │ ERR6913140 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:44:40 │ 94 │ 2256 │ 592656K │ cpu-node-1 │ │ 33582171_6.1 │ ERR6913195 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:44:38 │ 88 │ 2112 │ 329476K │ cpu-node-1 │ │ 33582171_7.1 │ ERR6913287 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:44:39 │ 125 │ 3000 │ 497960K │ cpu-node-25 │ │ 33582171_8.1 │ ERR6913289 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:44:39 │ 105 │ 2520 │ 588984K │ cpu-node-25 │ │ 33581966_1.1 │ ERR6913147 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:18 │ 83 │ 1992 │ 585232K │ cpu-node-57 │ │ 33581966_2.1 │ ERR6913154 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:15 │ 6 │ 144 │ 1240K │ cpu-node-57 │ │ 33581966_3.1 │ ERR6913157 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:16 │ 13 │ 312 │ 1236K │ cpu-node-27 │ │ 33581966_4.1 │ ERR6913165 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:16 │ 15 │ 360 │ 1244K │ cpu-node-28 │ │ 33581966_5.1 │ ERR6913250 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:17 │ 11 │ 264 │ 1240K │ cpu-node-29 │ │ 33581966_6.1 │ ERR6913243 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:21 │ 143 │ 3432 │ 687936K │ cpu-node-36 │ │ 33581966_7.1 │ ERR6913253 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:17 │ 4 │ 96 │ 1260K │ cpu-node-37 │ │ 33581966_8.1 │ ERR6913261 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:38:17 │ 2 │ 48 │ 1260K │ cpu-node-38 │ │ 33582026_1.1 │ ERR6913288 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:39:19 │ 118 │ 2832 │ 604504K │ cpu-node-15 │ │ 33582026_2.1 │ ERR6913310 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:39:18 │ 164 │ 3936 │ 597524K │ cpu-node-33 │ │ 33582026_3.1 │ ERR6913192 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:39:16 │ 36 │ 864 │ 340764K │ cpu-node-43 │ │ 33582026_4.1 │ ERR6913309 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:39:15 │ 26 │ 624 │ 1240K │ cpu-node-57 │ │ 33582026_5.1 │ ERR6913311 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:39:17 │ 82 │ 1968 │ 681648K │ cpu-node-67 │ │ 33582026_6.1 │ ERR6913338 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:39:18 │ 75 │ 1800 │ 301328K │ cpu-node-1 │ │ 33582026_7.1 │ ERR6913339 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:39:21 │ 145 │ 3480 │ 637936K │ cpu-node-1 │ │ 33582026_8.1 │ ERR6913340 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T14:39:21 │ 131 │ 3144 │ 602788K │ cpu-node-25 │ │ 33584167_1.1 │ ERR6913120 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:37:30 │ 16 │ 384 │ 1240K │ cpu-node-43 │ │ 33584167_2.1 │ ERR6913216 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:37:31 │ 6 │ 144 │ 1232K │ cpu-node-67 │ │ 33584167_3.1 │ ERR6913221 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:37:30 │ 3 │ 72 │ 1172K │ cpu-node-88 │ │ 33584167_4.1 │ ERR6913293 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:37:32 │ 46 │ 1104 │ 562276K │ cpu-node-25 │ │ 33584167_5.1 │ ERR6913125 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:37:31 │ 10 │ 240 │ 1264K │ cpu-node-25 │ │ 33584167_6.1 │ ERR6913215 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:37:30 │ 6 │ 144 │ 1232K │ cpu-node-27 │ │ 33584167_7.1 │ ERR6913322 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:37:35 │ 154 │ 3696 │ 717448K │ cpu-node-28 │ │ 33584168_1.1 │ ERR6913139 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:37:43 │ 217 │ 217 │ 449212K │ cpu-node-67 │ │ 33584168_2.1 │ ERR6913235 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:37:46 │ 284 │ 284 │ 464224K │ cpu-node-67 │ │ 33584168_3.1 │ ERR6913145 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:37:35 │ 77 │ 77 │ 314788K │ cpu-node-67 │ │ 33584168_4.1 │ ERR6913241 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:37:46 │ 245 │ 245 │ 375932K │ cpu-node-67 │ │ 33584168_5.1 │ ERR6913146 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:37:33 │ 57 │ 57 │ 465084K │ cpu-node-67 │ │ 33584168_6.1 │ ERR6913242 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:37:50 │ 230 │ 230 │ 494844K │ cpu-node-67 │ │ 33584168_7.1 │ ERR6913107 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:37:31 │ 21 │ 21 │ 1044K │ cpu-node-1 │ │ 33584168_8.1 │ ERR6913203 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T16:37:31 │ 8 │ 8 │ 1048K │ cpu-node-1 │ │ 33583541_1.1 │ ERR6913112 │ 12 │ 5Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:36:25 │ 4 │ 48 │ 1232K │ cpu-node-1 │ │ 33583541_2.1 │ ERR6913113 │ 12 │ 5Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:36:25 │ 19 │ 228 │ 1228K │ cpu-node-33 │ │ 33583541_3.1 │ ERR6913320 │ 12 │ 5Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:36:27 │ 121 │ 1452 │ 443864K │ cpu-node-33 │ │ 33583541_4.1 │ ERR6913209 │ 12 │ 5Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:36:25 │ 2 │ 24 │ 1228K │ cpu-node-43 │ │ 33583541_5.1 │ ERR6913122 │ 12 │ 5Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:36:27 │ 45 │ 540 │ 398692K │ cpu-node-43 │ │ 33583541_6.1 │ ERR6913208 │ 12 │ 5Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:36:25 │ 6 │ 72 │ 1228K │ cpu-node-67 │ │ 33583541_7.1 │ ERR6913218 │ 12 │ 5Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:36:24 │ 16 │ 192 │ 1228K │ cpu-node-67 │ │ 33583541_8.1 │ ERR6913349 │ 12 │ 5Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:36:29 │ 174 │ 2088 │ 565848K │ cpu-node-88 │ │ 33582966_1.2 │ ERR6913129_1 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:14:20 │ 30 │ 720 │ 1252K │ cpu-node-15 │ │ 33582966_1.3 │ ERR6913129_2 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:14:50 │ 27 │ 648 │ 1248K │ cpu-node-15 │ │ 33582966_2.2 │ ERR6913130_1 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:14:21 │ 45 │ 1080 │ 654200K │ cpu-node-23 │ │ 33582966_2.3 │ ERR6913130_2 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:15:06 │ 40 │ 960 │ 487608K │ cpu-node-23 │ │ 33582966_3.2 │ ERR6913194_1 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:14:26 │ 101 │ 2424 │ 560264K │ cpu-node-43 │ │ 33582966_3.3 │ ERR6913194_2 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:16:07 │ 101 │ 2424 │ 639208K │ cpu-node-43 │ │ 33582966_4.2 │ ERR6913196_1 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:14:26 │ 127 │ 3048 │ 681656K │ cpu-node-25 │ │ 33582966_4.3 │ ERR6913196_2 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:16:33 │ 126 │ 3024 │ 514504K │ cpu-node-25 │ │ 33582966_5.2 │ ERR6913225_1 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:14:29 │ 147 │ 3528 │ 564M │ cpu-node-25 │ │ 33582966_5.3 │ ERR6913225_2 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:16:56 │ 148 │ 3552 │ 689636K │ cpu-node-25 │ │ 33582966_6.2 │ ERR6913290_1 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:14:28 │ 151 │ 3624 │ 455952K │ cpu-node-27 │ │ 33582966_6.3 │ ERR6913290_2 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:16:59 │ 155 │ 3720 │ 696924K │ cpu-node-27 │ │ 33582966_7.2 │ ERR6913292_1 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:14:28 │ 160 │ 3840 │ 655824K │ cpu-node-28 │ │ 33582966_7.3 │ ERR6913292_2 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:17:08 │ 159 │ 3816 │ 508940K │ cpu-node-28 │ │ 33582966_8.2 │ ERR6913226_1 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:14:29 │ 163 │ 3912 │ 672988K │ cpu-node-29 │ │ 33582966_8.3 │ ERR6913226_2 │ 24 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T15:17:12 │ 161 │ 3864 │ 684616K │ cpu-node-29 │ │ 33584321_1.1 │ ERR6913116 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T17:02:32 │ 7 │ 7 │ 1064K │ cpu-node-33 │ │ 33584321_2.1 │ ERR6913212 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T17:02:31 │ 4 │ 4 │ 1056K │ cpu-node-33 │ │ 33584321_3.1 │ ERR6913136 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T17:02:42 │ 182 │ 182 │ 437004K │ cpu-node-33 │ │ 33584321_4.1 │ ERR6913232 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T17:02:49 │ 347 │ 347 │ 475712K │ cpu-node-33 │ │ 33584321_5.1 │ ERR6913118 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T17:02:32 │ 20 │ 20 │ 1064K │ cpu-node-33 │ │ 33584321_6.1 │ ERR6913214 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T17:02:32 │ 12 │ 12 │ 1060K │ cpu-node-1 │ │ 33584321_7.1 │ ERR6913108 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T17:02:32 │ 24 │ 24 │ 1060K │ cpu-node-1 │ │ 33584321_8.1 │ ERR6913204 │ 1 │ 2Gn │ │ COMPLETED │ 0:0 │ 2023-05-29T17:02:31 │ 7 │ 7 │ 1056K │ cpu-node-1 │ └───────────────┴──────────────┴─────────┴────────┴───────────┴───────────┴──────────┴─────────────────────┴────────────┴────────────┴─────────┴─────────────┘
library(DBI)
mydb <- dbConnect(RSQLite::SQLite(), "/shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db")
res_used <-dbGetQuery(mydb, 'select JobName,CPUTimeRAW,MaxRSS,read_count,base_count,patient_code,host_disease_status,nuc from blastn_viral_resources_used \
cpu inner join sample_annot spl on cpu.JobName=spl.run_accession;')
head(res_used)
| JobName | CPUTimeRAW | MaxRSS | read_count | base_count | patient_code | host_disease_status | nuc | |
|---|---|---|---|---|---|---|---|---|
| <chr> | <int> | <chr> | <int> | <int> | <chr> | <chr> | <chr> | |
| 1 | ERR6913101 | 87 | 490192K | 658268 | 80692720 | P4 | SARS-CoV-2 positive | DNA |
| 2 | ERR6913102 | 0 | 968K | 102524 | 13193813 | P11 | SARS-CoV-2 positive | DNA |
| 3 | ERR6913103 | 80 | 175240K | 385740 | 49060845 | P19 | SARS-CoV-2 positive | DNA |
| 4 | ERR6913104 | 396 | 432180K | 610606 | 76430173 | P22 | SARS-CoV-2 positive | DNA |
| 5 | ERR6913106 | 1632 | 515412K | 1271618 | 168661241 | P55 | SARS-CoV-2 positive | DNA |
| 6 | ERR6913107 | 21 | 1044K | 190648 | 24785538 | P66 | SARS-CoV-2 positive | DNA |
res_used$minutes <- as.integer(res_used$CPUTimeRAW) / 60
res_used$read_M <- res_used$read_count / 1000000
res_used$ram_M <- as.numeric(sub('K$','', res_used$MaxRSS, perl = TRUE)) / 1000
res_used$pat <- as.factor(res_used$patient_code)
head(res_used)
| JobName | CPUTimeRAW | MaxRSS | read_count | base_count | patient_code | host_disease_status | nuc | minutes | read_M | ram_M | pat | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| <chr> | <int> | <chr> | <int> | <int> | <chr> | <chr> | <chr> | <dbl> | <dbl> | <dbl> | <fct> | |
| 1 | ERR6913101 | 87 | 490192K | 658268 | 80692720 | P4 | SARS-CoV-2 positive | DNA | 1.450000 | 0.658268 | 490.192 | P4 |
| 2 | ERR6913102 | 0 | 968K | 102524 | 13193813 | P11 | SARS-CoV-2 positive | DNA | 0.000000 | 0.102524 | 0.968 | P11 |
| 3 | ERR6913103 | 80 | 175240K | 385740 | 49060845 | P19 | SARS-CoV-2 positive | DNA | 1.333333 | 0.385740 | 175.240 | P19 |
| 4 | ERR6913104 | 396 | 432180K | 610606 | 76430173 | P22 | SARS-CoV-2 positive | DNA | 6.600000 | 0.610606 | 432.180 | P22 |
| 5 | ERR6913106 | 1632 | 515412K | 1271618 | 168661241 | P55 | SARS-CoV-2 positive | DNA | 27.200000 | 1.271618 | 515.412 | P55 |
| 6 | ERR6913107 | 21 | 1044K | 190648 | 24785538 | P66 | SARS-CoV-2 positive | DNA | 0.350000 | 0.190648 | 1.044 | P66 |
library(ggplot2)
ggplot(res_used, aes(x=ram_M, y=minutes)) +
geom_point()+
geom_smooth(method=lm)+
theme_bw()
`geom_smooth()` using formula 'y ~ x'
cd /shared/projects/2314_medbioinfo/hui/MedBioinfo23
pwd
/shared/projects/2314_medbioinfo/hui/MedBioinfo23
mkdir analyses/kraken2
module load kraken2
kraken2 --help
Usage: kraken2 [options] <filename(s)>
Options:
--db NAME Name for Kraken 2 DB
(default: none)
--threads NUM Number of threads (default: 1)
--quick Quick operation (use first hit or hits)
--unclassified-out FILENAME
Print unclassified sequences to filename
--classified-out FILENAME
Print classified sequences to filename
--output FILENAME Print output to filename (default: stdout); "-" will
suppress normal output
--confidence FLOAT Confidence score threshold (default: 0.0); must be
in [0, 1].
--minimum-base-quality NUM
Minimum base quality used in classification (def: 0,
only effective with FASTQ input).
--report FILENAME Print a report with aggregrate counts/clade to file
--use-mpa-style With --report, format report output like Kraken 1's
kraken-mpa-report
--report-zero-counts With --report, report counts for ALL taxa, even if
counts are zero
--report-minimizer-data With --report, report minimizer and distinct minimizer
count information in addition to normal Kraken report
--memory-mapping Avoids loading database into RAM
--paired The filenames provided have paired-end reads
--use-names Print scientific names instead of just taxids
--gzip-compressed Input files are compressed with gzip
--bzip2-compressed Input files are compressed with bzip2
--minimum-hit-groups NUM
Minimum number of hit groups (overlapping k-mers
sharing the same minimizer) needed to make a call
(default: 2)
--help Print this message
--version Print version information
If none of the *-compressed flags are specified, and the filename provided
is a regular file, automatic format detection is attempted.
pwd
/shared/projects/2314_medbioinfo/hui/MedBioinfo23
cp scripts/fastq_blastn_vs_nt_refseq_sbatch.sh scripts/kraken_sbatch.sh
ls /shared/projects/2314_medbioinfo/kraken2/arch_bact_vir_hum_protoz_fung/
database100mers.kmer_distrib database50mers.kmer_distrib opts.k2d database150mers.kmer_distrib database75mers.kmer_distrib seqid2taxid.map database200mers.kmer_distrib hash.k2d taxo.k2d database250mers.kmer_distrib inspect.txt database300mers.kmer_distrib ktaxonomy.tsv
sbatch scripts/kraken_sbatch.sh
Submitted batch job 33591789
sacct --format=JobName%20,ReqCPUS,ReqMem,State,ExitCode,elapsed,MaxRSS,NodeList -j 33591789
JobName ReqCPUS ReqMem State ExitCode Elapsed MaxRSS NodeList
-------------------- -------- ---------- ---------- -------- ---------- ---------- ---------------
MedBioinfo 16 90Gn COMPLETED 0:0 00:02:31 cpu-node-73
batch 16 90Gn COMPLETED 0:0 00:02:31 7940K cpu-node-73
kraken2_vs_abvhp 16 90Gn COMPLETED 0:0 00:02:28 71848464K cpu-node-73
head analyses/kraken2/kraken_vs_abvhp.kraken
U ERR6913158.1.1 0 149|150 0:115 |:| 0:116 U ERR6913158.2.1 0 93|93 0:59 |:| 0:59 U ERR6913158.3.1 0 151|149 0:117 |:| 0:115 U ERR6913158.4.1 0 88|88 0:54 |:| 0:54 U ERR6913158.5.1 0 151|149 0:117 |:| 0:115 U ERR6913158.6.1 0 69|69 0:35 |:| 0:35 U ERR6913158.7.1 0 151|149 0:117 |:| 0:115 U ERR6913158.8.1 0 148|151 0:114 |:| 0:117 C ERR6913158.9.1 1224 150|150 0:10 1224:5 0:101 |:| 0:103 1224:5 0:8 C ERR6913158.10.1 2772066 129|129 0:17 2772066:2 0:76 |:| 0:76 2772066:2 0:17
head analyses/kraken2/kraken_vs_abvhp.kraken.report
92.52 699069 699069 U 0 unclassified 7.48 56538 98 R 1 root 7.33 55360 121 R1 131567 cellular organisms 6.99 52796 1043 D 2 Bacteria 4.02 30374 652 P 1224 Pseudomonadota 2.05 15471 299 C 1236 Gammaproteobacteria 0.54 4109 1 O 72274 Pseudomonadales 0.54 4053 42 F 135621 Pseudomonadaceae 0.48 3602 966 G 286 Pseudomonas 0.14 1048 134 G1 196821 unclassified Pseudomonas
ls -lh /shared/projects/2314_medbioinfo/hui/MedBioinfo23/data/sra_fastq
total 120M -rw-rw----+ 1 huiyu huiyu 1.5M May 24 23:00 ERR6913156_1.fastq.gz -rw-rw----+ 1 huiyu huiyu 1.5M May 24 23:00 ERR6913156_2.fastq.gz -rw-rw----+ 1 huiyu huiyu 45M May 24 23:03 ERR6913158_1.fastq.gz -rw-rw----+ 1 huiyu huiyu 46M May 24 23:03 ERR6913158_2.fastq.gz -rw-rw----+ 1 huiyu huiyu 4.3M May 24 23:03 ERR6913168_1.fastq.gz -rw-rw----+ 1 huiyu huiyu 4.4M May 24 23:03 ERR6913168_2.fastq.gz -rw-rw----+ 1 huiyu huiyu 5.0M May 24 23:03 ERR6913169_1.fastq.gz -rw-rw----+ 1 huiyu huiyu 5.0M May 24 23:03 ERR6913169_2.fastq.gz -rw-rw----+ 1 huiyu huiyu 578K May 24 23:03 ERR6913252_1.fastq.gz -rw-rw----+ 1 huiyu huiyu 585K May 24 23:03 ERR6913252_2.fastq.gz -rw-rw----+ 1 huiyu huiyu 2.4M May 24 23:04 ERR6913254_1.fastq.gz -rw-rw----+ 1 huiyu huiyu 2.4M May 24 23:04 ERR6913254_2.fastq.gz -rw-rw----+ 1 huiyu huiyu 485K May 24 23:03 ERR6913264_1.fastq.gz -rw-rw----+ 1 huiyu huiyu 491K May 24 23:03 ERR6913264_2.fastq.gz -rw-rw----+ 1 huiyu huiyu 798K May 24 23:03 ERR6913265_1.fastq.gz -rw-rw----+ 1 huiyu huiyu 800K May 24 23:03 ERR6913265_2.fastq.gz
sbatch scripts/kraken_sbatch.sh
Submitted batch job 33592127
sacct --format=JobName%20,ReqCPUS,ReqMem,State,ExitCode,elapsed,MaxRSS,NodeList -j 33592127
JobName ReqCPUS ReqMem State ExitCode Elapsed MaxRSS NodeList
-------------------- -------- ---------- ---------- -------- ---------- ---------- ---------------
MedBioinfo 16 90Gn COMPLETED 0:0 00:01:45 cpu-node-57
batch 16 90Gn COMPLETED 0:0 00:01:45 7928K cpu-node-57
kraken2_vs_abvhp 16 90Gn COMPLETED 0:0 00:01:43 66994456K cpu-node-57
sbatch scripts/kraken_sbatch.sh
Submitted batch job 33592461
sacct --format=JobName%20,ReqCPUS,ReqMem,State,ExitCode,elapsed,MaxRSS,NodeList -j 33592461
JobName ReqCPUS ReqMem State ExitCode Elapsed MaxRSS NodeList
-------------------- -------- ---------- ---------- -------- ---------- ---------- ---------------
MedBioinfo 16 90Gn COMPLETED 0:0 00:02:56 cpu-node-73
batch 16 90Gn COMPLETED 0:0 00:02:56 7932K cpu-node-73
kraken2_vs_abvhp 16 90Gn COMPLETED 0:0 00:02:55 65988M cpu-node-73
cd /shared/projects/2314_medbioinfo/hui/MedBioinfo23
pwd
/shared/projects/2314_medbioinfo/hui/MedBioinfo23
module load bracken
module load seqkit
bracken -help
/shared/ifbstor1/software/miniconda/envs/bracken-2.6.1/bin/bracken: illegal option -- h Usage: bracken -d MY_DB -i INPUT -o OUTPUT -w OUTREPORT -r READ_LEN -l LEVEL -t THRESHOLD MY_DB location of Kraken database INPUT Kraken REPORT file to use for abundance estimation OUTPUT file name for Bracken default output OUTREPORT New Kraken REPORT output file with Bracken read estimates READ_LEN read length to get all classifications for (default: 100) LEVEL level to estimate abundance at [options: D,P,C,O,F,G,S,S1,etc] (default: S) THRESHOLD number of reads required PRIOR to abundance estimation to perform reestimation (default: 0)
seqkit stats data/sra_fastq/ERR6913158_1.fastq.gz
file format type num_seqs sum_len min_len avg_len max_len data/sra_fastq/ERR6913158_1.fastq.gz FASTQ DNA 755,607 96,068,088 35 127.1 151
ls -lh data/sra_fastq
total 120M -rw-rw----+ 1 huiyu huiyu 1.5M May 24 23:00 ERR6913156_1.fastq.gz -rw-rw----+ 1 huiyu huiyu 1.5M May 24 23:00 ERR6913156_2.fastq.gz -rw-rw----+ 1 huiyu huiyu 45M May 24 23:03 ERR6913158_1.fastq.gz -rw-rw----+ 1 huiyu huiyu 46M May 24 23:03 ERR6913158_2.fastq.gz -rw-rw----+ 1 huiyu huiyu 4.3M May 24 23:03 ERR6913168_1.fastq.gz -rw-rw----+ 1 huiyu huiyu 4.4M May 24 23:03 ERR6913168_2.fastq.gz -rw-rw----+ 1 huiyu huiyu 5.0M May 24 23:03 ERR6913169_1.fastq.gz -rw-rw----+ 1 huiyu huiyu 5.0M May 24 23:03 ERR6913169_2.fastq.gz -rw-rw----+ 1 huiyu huiyu 578K May 24 23:03 ERR6913252_1.fastq.gz -rw-rw----+ 1 huiyu huiyu 585K May 24 23:03 ERR6913252_2.fastq.gz -rw-rw----+ 1 huiyu huiyu 2.4M May 24 23:04 ERR6913254_1.fastq.gz -rw-rw----+ 1 huiyu huiyu 2.4M May 24 23:04 ERR6913254_2.fastq.gz -rw-rw----+ 1 huiyu huiyu 485K May 24 23:03 ERR6913264_1.fastq.gz -rw-rw----+ 1 huiyu huiyu 491K May 24 23:03 ERR6913264_2.fastq.gz -rw-rw----+ 1 huiyu huiyu 798K May 24 23:03 ERR6913265_1.fastq.gz -rw-rw----+ 1 huiyu huiyu 800K May 24 23:03 ERR6913265_2.fastq.gz
sbatch scripts/kraken_bracken_sbatch.sh
Submitted batch job 33594008
sacct --format=JobName%20,ReqCPUS,ReqMem,State,ExitCode,elapsed,MaxRSS,NodeList -j 33594008
JobName ReqCPUS ReqMem State ExitCode Elapsed MaxRSS NodeList
-------------------- -------- ---------- ---------- -------- ---------- ---------- ---------------
MedBioinfo 16 90Gn COMPLETED 0:0 00:02:08 cpu-node-11
batch 16 90Gn COMPLETED 0:0 00:02:08 7936K cpu-node-11
kraken2_vs_abvhp 16 90Gn COMPLETED 0:0 00:02:06 72704412K cpu-node-11
kraken2_bracken 16 90Gn COMPLETED 0:0 00:00:00 1232K cpu-node-11
workdir="/shared/projects/2314_medbioinfo/hui/MedBioinfo23/analyses/kraken_bracken"
datadir="/shared/projects/2314_medbioinfo/hui/MedBioinfo23/data/merged_pairs"
input_file1="/shared/projects/2314_medbioinfo/hui/MedBioinfo23/data/sra_fastq/ERR6913158_1.fastq.gz"
input_file2="/shared/projects/2314_medbioinfo/hui/MedBioinfo23/data/sra_fastq/ERR6913158_2.fastq.gz"
#accnum_file="/shared/projects/2314_medbioinfo/hui/MedBioinfo23/analyses/huiyu_run_accession.txt"
output_file=${workdir}/kraken_vs_abvhp
#accnum_file="/shared/projects/2314_medbioinfo/hui/file_of_acc_nums.txt"
db="/shared/projects/2314_medbioinfo/kraken2/arch_bact_vir_hum_protoz_fung"
# srun --job-name=kraken2_bracken
bracken -d ${db} -i ${output_file}.ERR6913158.kraken.report -o ${output_file}.ERR6913158.bracken -w ${output_file}.ERR6913158.bracken.report
>> Checking for Valid Options...
>> Running Bracken
>> python src/est_abundance.py -i /shared/projects/2314_medbioinfo/hui/MedBioinfo23/analyses/kraken_bracken/kraken_vs_abvhp.ERR6913158.kraken.report -o /shared/projects/2314_medbioinfo/hui/MedBioinfo23/analyses/kraken_bracken/kraken_vs_abvhp.ERR6913158.bracken -k /shared/projects/2314_medbioinfo/kraken2/arch_bact_vir_hum_protoz_fung/database100mers.kmer_distrib -l S -t 10
PROGRAM START TIME: 05-30-2023 15:01:55
>> Checking report file: /shared/projects/2314_medbioinfo/hui/MedBioinfo23/analyses/kraken_bracken/kraken_vs_abvhp.ERR6913158.kraken.report
BRACKEN SUMMARY (Kraken report: /shared/projects/2314_medbioinfo/hui/MedBioinfo23/analyses/kraken_bracken/kraken_vs_abvhp.ERR6913158.kraken.report)
>>> Threshold: 10
>>> Number of species in sample: 6628
>> Number of species with reads > threshold: 645
>> Number of species with reads < threshold: 5983
>>> Total reads in sample: 755607
>> Total reads kept at species level (reads > threshold): 25338
>> Total reads discarded (species reads < threshold): 18485
>> Reads distributed: 36789
>> Reads not distributed (eg. no species above threshold): 19749
>> Unclassified reads: 699069
BRACKEN OUTPUT PRODUCED: /shared/projects/2314_medbioinfo/hui/MedBioinfo23/analyses/kraken_bracken/kraken_vs_abvhp.ERR6913158.bracken
PROGRAM END TIME: 05-30-2023 15:01:55
Bracken complete.
head analyses/kraken_bracken/kraken_vs_abvhp.ERR6913158.bracken
name taxonomy_id taxonomy_lvl kraken_assigned_reads added_reads new_est_reads fraction_total_reads Pseudomonas sp. FDAARGOS_380 2018067 S 224 128 352 0.00957 Pseudomonas sp. T1-3-2 2908006 S 115 7 122 0.00332 Pseudomonas sp. PIA16 2931382 S 43 2 45 0.00122 Pseudomonas sp. SDM007 2812000 S 15 15 30 0.00082 Pseudomonas sp. J380 2605424 S 13 34 47 0.00128 Pseudomonas sp. ATCC 13867 1294143 S 12 3 15 0.00041 Pseudomonas sp. L5B5 2883205 S 12 1 13 0.00035 Pseudomonas sp. LG1E9 2219057 S 11 3 14 0.00038 Pseudomonas sp. SCB32 2653853 S 11 2 13 0.00035
sort analyses/kraken_bracken/kraken_vs_abvhp.ERR6913158.bracken -t$'\t' -r -n -k 6 | head
Acinetobacter junii 40215 S 2292 485 2777 0.07548 Cutibacterium acnes 1747 S 2020 494 2514 0.06834 Vibrio fluvialis 676 S 1649 812 2461 0.06689 Burkholderia multivorans 87883 S 1227 252 1479 0.04020 Enterococcus cecorum 44008 S 1225 179 1404 0.03816 Homo sapiens 9606 S 1115 65 1180 0.03207 Pseudomonas aeruginosa 287 S 95 965 1060 0.02881 Corynebacterium propinquum 43769 S 807 94 901 0.02449 Shewanella algae 38313 S 680 163 843 0.02291 Stutzerimonas stutzeri 316 S 290 97 387 0.01052
ls /shared/projects/2314_medbioinfo/kraken2/KrakenTools
combine_kreports.py filter_bracken.out.py LICENSE combine_mpa.py fix_unmapped.py make_kreport.py DiversityTools kreport2krona.py make_ktaxonomy.py extract_kraken_reads.py kreport2mpa.py README.md
python /shared/projects/2314_medbioinfo/kraken2/KrakenTools/kreport2krona.py -h
usage: kreport2krona.py [-h] -r R_FILE -o O_FILE [--intermediate-ranks]
[--no-intermediate-ranks]
optional arguments:
-h, --help show this help message and exit
-r R_FILE, --report-file R_FILE, --report R_FILE
Input kraken report file for converting
-o O_FILE, --output O_FILE
Output krona-report file name
--intermediate-ranks Include non-traditional taxonomic ranks in output
--no-intermediate-ranks
Do not include non-traditional taxonomic ranks in
output [default: no intermediate ranks]
mkdir analyses/krona
pwd
/shared/projects/2314_medbioinfo/hui/MedBioinfo23
# kraken_vs_abvhp.ERR6913158.bracken
ls ./analyses/kraken_bracken
kraken_vs_abvhp.ERR6913158.bracken kraken_vs_abvhp.ERR6913158.bracken.report kraken_vs_abvhp.ERR6913158.kraken kraken_vs_abvhp.ERR6913158.kraken.report slurm.33594008.4294967294.err slurm.33594008.4294967294.out
kreport2krona="/shared/projects/2314_medbioinfo/kraken2/KrakenTools/kreport2krona.py"
python $kreport2krona -r ./analyses/kraken_bracken/kraken_vs_abvhp.ERR6913158.bracken.report -o ./analyses/krona/ERR6913158.krona
cat /shared/projects/2314_medbioinfo/kraken2/bin/ktImportText
#!/usr/bin/env perl
# Copyright © 2011, Battelle National Biodefense Institute (BNBI);
# all rights reserved. Authored by: Brian Ondov, Nicholas Bergman, and
# Adam Phillippy
#
# See the LICENSE.txt file included with this software for license information.
use strict;
BEGIN
{
use File::Basename;
use Cwd 'abs_path';
use lib dirname(abs_path($0)) . "/../lib";
use KronaTools;
}
setOption('out', 'text.krona.html');
setOption('name', 'all');
my @options =
qw(
out
name
noMag
combine
url
);
getKronaOptions(@options);
if
(
@ARGV < 1
)
{
printUsage
(
'Creates a Krona chart from text files listing quantities and
lineages.',
'text',
'Tab-delimited text file. Each line should be a number followed by a
list of wedges to contribute to (starting from the highest level). If no wedges
are listed (and just a quantity is given), it will contribute to the top level.
If the same lineage is listed more than once, the values will be added.
Quantities can be omitted if -q is specified. Lines beginning with "#" will be
ignored.',
0,
1,
\@options
);
exit 0;
}
my $tree = newTree();
my @datasetNames;
my $set = 0;
foreach my $input ( @ARGV )
{
my ($fileName, $magFile, $name) = parseDataset($input);
if ( ! getOption('combine') )
{
push @datasetNames, $name;
}
open INFILE, "<$fileName" or die $!;
while ( <INFILE> )
{
if ( /^#/ )
{
next;
}
chomp;
my @lineage = split /\t/;
my $magnitude;
if ( getOption('noMag') )
{
$magnitude = 1;
}
else
{
$magnitude = shift @lineage;
}
addByLineage($tree, $set, \@lineage, undef, $magnitude);
}
if ( ! getOption('combine') )
{
$set++;
}
close INFILE;
}
my @attributeNames =
(
'magnitude',
'magnitudeUnassigned'
);
my @attributeDisplayNames =
(
'Total',
'Unassigned'
);
writeTree
(
$tree,
\@attributeNames,
\@attributeDisplayNames,
\@datasetNames
);
/shared/projects/2314_medbioinfo/kraken2/bin/ktImportText -o ./analyses/krona/ERR6913158.krona.html ./analyses/krona/ERR6913158.krona
Writing ./analyses/krona/ERR6913158.krona.html...
cp -r analyses/kraken_bracken analyses/kraken_bracken_backup
sbatch scripts/kraken_2_krona.sh
Submitted batch job 33600060
sacct --format=JobName%20,ReqCPUS,ReqMem,State,ExitCode,elapsed,MaxRSS,NodeList -j 33600060
JobName ReqCPUS ReqMem State ExitCode Elapsed MaxRSS NodeList
-------------------- -------- ---------- ---------- -------- ---------- ---------- ---------------
kraken2krona 16 80Gn COMPLETED 0:0 00:07:35 cpu-node-72
batch 16 80Gn COMPLETED 0:0 00:07:35 7944K cpu-node-72
ERR6913156 16 80Gn COMPLETED 0:0 00:07:32 65705324K cpu-node-72
bracken 16 80Gn COMPLETED 0:0 00:00:01 1148K cpu-node-72
k2krona 16 80Gn COMPLETED 0:0 00:00:00 1144K cpu-node-72
kraken2krona 16 80Gn COMPLETED 0:0 00:06:39 cpu-node-74
batch 16 80Gn COMPLETED 0:0 00:06:39 7940K cpu-node-74
ERR6913158 16 80Gn COMPLETED 0:0 00:06:35 72761412K cpu-node-74
bracken 16 80Gn COMPLETED 0:0 00:00:00 1140K cpu-node-74
k2krona 16 80Gn COMPLETED 0:0 00:00:01 1140K cpu-node-74
kraken2krona 16 80Gn COMPLETED 0:0 00:06:43 cpu-node-82
batch 16 80Gn COMPLETED 0:0 00:06:43 7944K cpu-node-82
ERR6913169 16 80Gn COMPLETED 0:0 00:06:38 70817180K cpu-node-82
bracken 16 80Gn COMPLETED 0:0 00:00:01 1152K cpu-node-82
k2krona 16 80Gn COMPLETED 0:0 00:00:00 1152K cpu-node-82
kraken2krona 16 80Gn COMPLETED 0:0 00:07:18 cpu-node-39
batch 16 80Gn COMPLETED 0:0 00:07:18 7960K cpu-node-39
ERR6913264 16 80Gn COMPLETED 0:0 00:07:15 68867768K cpu-node-39
bracken 16 80Gn COMPLETED 0:0 00:00:01 1240K cpu-node-39
k2krona 16 80Gn COMPLETED 0:0 00:00:00 1232K cpu-node-39
kraken2krona 16 80Gn COMPLETED 0:0 00:07:13 cpu-node-40
batch 16 80Gn COMPLETED 0:0 00:07:13 7912K cpu-node-40
ERR6913265 16 80Gn COMPLETED 0:0 00:07:10 70276512K cpu-node-40
bracken 16 80Gn COMPLETED 0:0 00:00:00 1236K cpu-node-40
k2krona 16 80Gn COMPLETED 0:0 00:00:00 1232K cpu-node-40
kraken2krona 16 80Gn COMPLETED 0:0 00:07:23 cpu-node-52
batch 16 80Gn COMPLETED 0:0 00:07:23 7932K cpu-node-52
ERR6913168 16 80Gn COMPLETED 0:0 00:07:19 69047508K cpu-node-52
bracken 16 80Gn COMPLETED 0:0 00:00:01 1232K cpu-node-52
k2krona 16 80Gn COMPLETED 0:0 00:00:00 1232K cpu-node-52
kraken2krona 16 80Gn COMPLETED 0:0 00:07:34 cpu-node-11
batch 16 80Gn COMPLETED 0:0 00:07:34 7920K cpu-node-11
ERR6913252 16 80Gn COMPLETED 0:0 00:07:33 72078732K cpu-node-11
bracken 16 80Gn COMPLETED 0:0 00:00:01 1248K cpu-node-11
k2krona 16 80Gn COMPLETED 0:0 00:00:00 1248K cpu-node-11
kraken2krona 16 80Gn COMPLETED 0:0 00:05:43 cpu-node-70
batch 16 80Gn COMPLETED 0:0 00:05:43 7940K cpu-node-70
ERR6913254 16 80Gn COMPLETED 0:0 00:05:39 71292320K cpu-node-70
bracken 16 80Gn COMPLETED 0:0 00:00:01 1152K cpu-node-70
k2krona 16 80Gn COMPLETED 0:0 00:00:00 1140K cpu-node-70
ls /shared/projects/2314_medbioinfo/kraken2/bin/ktImportText
/shared/projects/2314_medbioinfo/kraken2/bin/ktImportText
for file in analyses/kraken_vs_abvhp/*.krona
do
/shared/projects/2314_medbioinfo/kraken2/bin/ktImportText -o $file.html $file
done
Writing analyses/kraken_vs_abvhp/ERR6913156.bracken.report.krona.html... Writing analyses/kraken_vs_abvhp/ERR6913158.bracken.report.krona.html... Writing analyses/kraken_vs_abvhp/ERR6913168.bracken.report.krona.html... Writing analyses/kraken_vs_abvhp/ERR6913169.bracken.report.krona.html... Writing analyses/kraken_vs_abvhp/ERR6913252.bracken.report.krona.html... Writing analyses/kraken_vs_abvhp/ERR6913254.bracken.report.krona.html... Writing analyses/kraken_vs_abvhp/ERR6913264.bracken.report.krona.html... Writing analyses/kraken_vs_abvhp/ERR6913265.bracken.report.krona.html...
for file in analyses/kraken_vs_abvhp/*.krona
do
sed -E 's/[a-z]//g' $file > $file_clean
/shared/projects/2314_medbioinfo/kraken2/bin/ktImportText -o $file.html $file
done
rm -r analyses/kraken_vs_abvhp/*.krona_clean
rm -r analyses/kraken_vs_abvhp/*.krona_clean.html
for file in analyses/kraken_vs_abvhp/*.krona
do
sed -e 's/[a-z]__//g' ${file} > ${file}_clean
/shared/projects/2314_medbioinfo/kraken2/bin/ktImportText -o ${file}_clean.html ${file}_clean
done
Writing analyses/kraken_vs_abvhp/ERR6913156.bracken.report.krona_clean.html... Writing analyses/kraken_vs_abvhp/ERR6913158.bracken.report.krona_clean.html... Writing analyses/kraken_vs_abvhp/ERR6913168.bracken.report.krona_clean.html... Writing analyses/kraken_vs_abvhp/ERR6913169.bracken.report.krona_clean.html... Writing analyses/kraken_vs_abvhp/ERR6913252.bracken.report.krona_clean.html... Writing analyses/kraken_vs_abvhp/ERR6913254.bracken.report.krona_clean.html... Writing analyses/kraken_vs_abvhp/ERR6913264.bracken.report.krona_clean.html... Writing analyses/kraken_vs_abvhp/ERR6913265.bracken.report.krona_clean.html...
/shared/projects/2314_medbioinfo/kraken2/bin/ktImportText -o analyses/kraken_vs_abvhp/all.html analyses/kraken_vs_abvhp/*.krona_clean
Writing analyses/kraken_vs_abvhp/all.html...
cd analyses/kraken_vs_abvhp
sacct -P --format=JobID%15,JobName%18,ReqCPUS,ReqMem,Timelimit,State,ExitCode,Start,elapsedRAW,CPUTimeRAW,MaxRSS,NodeList -j 33600060 \
| grep ERR > kraken2_full_FASTQ_vs_viral_sbatch_array.sacct
sqlite3 -batch -separator "|" /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db \
".import ./kraken2_full_FASTQ_vs_viral_sbatch_array.sacct kraken2_viral_resources_used"
sqlite3 -box -batch /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db "select * from kraken2_viral_resources_used where JobID like '33600060%';"
┌──────────────┬────────────┬─────────┬────────┬───────────┬───────────┬──────────┬─────────────────────┬────────────┬────────────┬───────────┬─────────────┐ │ JobID │ JobName │ ReqCPUS │ ReqMem │ Timelimit │ State │ ExitCode │ Start │ ElapsedRAW │ CPUTimeRAW │ MaxRSS │ NodeList │ ├──────────────┼────────────┼─────────┼────────┼───────────┼───────────┼──────────┼─────────────────────┼────────────┼────────────┼───────────┼─────────────┤ │ 33600060_1.0 │ ERR6913156 │ 16 │ 80Gn │ │ COMPLETED │ 0:0 │ 2023-05-31T11:15:32 │ 452 │ 7232 │ 65705324K │ cpu-node-72 │ │ 33600060_2.0 │ ERR6913158 │ 16 │ 80Gn │ │ COMPLETED │ 0:0 │ 2023-05-31T11:15:32 │ 395 │ 6320 │ 72761412K │ cpu-node-74 │ │ 33600060_3.0 │ ERR6913169 │ 16 │ 80Gn │ │ COMPLETED │ 0:0 │ 2023-05-31T11:15:32 │ 398 │ 6368 │ 70817180K │ cpu-node-82 │ │ 33600060_4.0 │ ERR6913264 │ 16 │ 80Gn │ │ COMPLETED │ 0:0 │ 2023-05-31T11:15:32 │ 435 │ 6960 │ 68867768K │ cpu-node-39 │ │ 33600060_5.0 │ ERR6913265 │ 16 │ 80Gn │ │ COMPLETED │ 0:0 │ 2023-05-31T11:15:33 │ 430 │ 6880 │ 70276512K │ cpu-node-40 │ │ 33600060_6.0 │ ERR6913168 │ 16 │ 80Gn │ │ COMPLETED │ 0:0 │ 2023-05-31T11:15:33 │ 439 │ 7024 │ 69047508K │ cpu-node-52 │ │ 33600060_7.0 │ ERR6913252 │ 16 │ 80Gn │ │ COMPLETED │ 0:0 │ 2023-05-31T11:16:31 │ 453 │ 7248 │ 72078732K │ cpu-node-11 │ │ 33600060_8.0 │ ERR6913254 │ 16 │ 80Gn │ │ COMPLETED │ 0:0 │ 2023-05-31T11:18:02 │ 339 │ 5424 │ 71292320K │ cpu-node-70 │ └──────────────┴────────────┴─────────┴────────┴───────────┴───────────┴──────────┴─────────────────────┴────────────┴────────────┴───────────┴─────────────┘
cd /shared/projects/2314_medbioinfo/hui/MedBioinfo23
module load multiqc
multiqc --force --title "MultiQC" ../data/merged_pairs/ ./fastqc/ ./kraken_vs_abvhp/ ./blastn/
/// ]8;id=301121;https://multiqc.info\MultiQC]8;;\ 🔍 | v1.13 | multiqc | MultiQC Version v1.14 now available! | multiqc | Report title: MultiQC | multiqc | Search path : /shared/ifbstor1/projects/2314_medbioinfo/hui/MedBioinfo23/data/merged_pairs | multiqc | Search path : /shared/ifbstor1/projects/2314_medbioinfo/hui/MedBioinfo23/analyses/fastqc | multiqc | Search path : /shared/ifbstor1/projects/2314_medbioinfo/hui/MedBioinfo23/analyses/kraken_vs_abvhp | multiqc | Search path : /shared/ifbstor1/projects/2314_medbioinfo/hui/MedBioinfo23/analyses/blastn | searching | ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 100% 283/283 0mut/slurm.33590656.2.err1.err | kraken | Found 17 reports | fastqc | Found 16 reports | flash | Found 8 histogram reports | multiqc | Compressing plot data | multiqc | Report : MultiQC_multiqc_report.html | multiqc | Data : MultiQC_multiqc_report_data | multiqc | MultiQC complete
xargs -a ./analyses/huiyu_run_accession.txt -I{} sed -E 's/^/{}\t/' ./analyses/kraken_vs_abvhp/{}.bracken >> ./analyses/bracken_combined.tsv
head ./analyses/bracken_combined.tsv
echo "======="
grep -v "kraken_assigned_reads" ./analyses/bracken_combined.tsv > ./analyses/bracken_combined_no_headers.tsv
head ./analyses/bracken_combined_no_headers.tsv
echo "======="
tail ./analyses/bracken_combined_no_headers.tsv
echo "======="
wc -l ./analyses/bracken_combined_no_headers.tsv
ERR6913156 name taxonomy_id taxonomy_lvl kraken_assigned_reads added_reads new_est_reads fraction_total_reads ERR6913156 Cutibacterium acnes 1747 S 175 12 187 0.21347 ERR6913156 Corynebacterium kefirresidentii 1979527 S 60 26 86 0.09817 ERR6913156 Lactobacillus crispatus 47770 S 35 9 44 0.05023 ERR6913156 Dolosigranulum pigrum 29394 S 29 4 33 0.03767 ERR6913156 Staphylococcus saprophyticus 29385 S 16 21 37 0.04224 ERR6913156 Acinetobacter junii 40215 S 67 66 133 0.15183 ERR6913156 Vibrio fluvialis 676 S 12 9 21 0.02397 ERR6913156 Schlegelella aquatica 376175 S 10 12 22 0.02511 ERR6913156 Homo sapiens 9606 S 219 7 226 0.25799 ======= ERR6913156 Cutibacterium acnes 1747 S 175 12 187 0.21347 ERR6913156 Corynebacterium kefirresidentii 1979527 S 60 26 86 0.09817 ERR6913156 Lactobacillus crispatus 47770 S 35 9 44 0.05023 ERR6913156 Dolosigranulum pigrum 29394 S 29 4 33 0.03767 ERR6913156 Staphylococcus saprophyticus 29385 S 16 21 37 0.04224 ERR6913156 Acinetobacter junii 40215 S 67 66 133 0.15183 ERR6913156 Vibrio fluvialis 676 S 12 9 21 0.02397 ERR6913156 Schlegelella aquatica 376175 S 10 12 22 0.02511 ERR6913156 Homo sapiens 9606 S 219 7 226 0.25799 ERR6913156 Aspergillus chevalieri 182096 S 82 1 83 0.09475 ======= ERR6913254 Thalassiosira pseudonana 35128 S 383 26 409 0.05449 ERR6913254 Toxoplasma gondii 5811 S 22 25 47 0.00626 ERR6913254 Bigelowiella natans 227086 S 17 0 17 0.00226 ERR6913254 Malassezia restricta 76775 S 53 8 61 0.00813 ERR6913254 Homo sapiens 9606 S 80 28 108 0.01439 ERR6913254 Cryptomonas paramecium 2898 S 19 7 26 0.00346 ERR6913254 Guillardia theta 55529 S 19 10 29 0.00386 ERR6913254 Natronomonas moolapensis 416273 S 25 14 39 0.00520 ERR6913254 Human mastadenovirus C 129951 S 38 0 38 0.00506 ERR6913254 Severe acute respiratory syndrome-related coronavirus 694009 S 17 0 17 0.00226 ======= 824 ./analyses/bracken_combined_no_headers.tsv
sqlite3 /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db \
'CREATE TABLE IF NOT EXISTS "bracken_abundances_long"(
"run_accession" TEXT,
"taxon_name" TEXT,
"taxonomy_id" INTEGER,
"taxonomy_lvl" TEXT,
"kraken_assigned_reads" INTEGER,
"added_reads" INTEGER,
"new_est_reads" INTEGER,
"fraction_total_reads" REAL,
PRIMARY_KEY:run_accession, taxonomy_id);"
sqlite3 -batch -tabs /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db \
'.import /shared/projects/2314_medbioinfo/hui/MedBioinfo23/analyses/bracken_combined_no_headers.tsv bracken_abundances_long'
cut -f1 analyses/bracken_combined_no_headers.tsv | sort | uniq -c
10 ERR6913156
645 ERR6913158
27 ERR6913168
26 ERR6913169
12 ERR6913252
74 ERR6913254
10 ERR6913264
20 ERR6913265
sqlite3 -batch /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db \
'.table'
CtValues braken_abundances_long ENARunTable kraken2_viral_resources_used SampleOverviews kraken2_viral_resources_used_2 SraRunTable kraken2_viral_resources_used_bak bioinformaticians sample2bioinformatician blastn_viral_resources_used sample_annot bracken_abundances_long sample_annot_all
sqlite3 -batch /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db \
'SELECT username, run_accession, count(*)
FROM (bracken_abundances_long abu left join sample_annot using(run_accession))
left join sample2bioinformatician sb using(patient_code) group by username,run_accession order by username;'
username run_accession count(*)
--------------- ------------- --------
ERR6913107 40
ERR6913139 621
ERR6913145 270
ERR6913146 175
ERR6913203 29
ERR6913235 1227
ERR6913241 999
ERR6913242 1973
aarzoomand ERR6913305 566
aarzoomand ERR6913306 277
aarzoomand ERR6913307 329
aarzoomand ERR6913308 331
aarzoomand ERR6913334 353
aarzoomand ERR6913335 355
aarzoomand ERR6913336 237
aarzoomand ERR6913337 284
akarlsson ERR6913104 645
akarlsson ERR6913131 797
akarlsson ERR6913132 1506
akarlsson ERR6913133 2196
akarlsson ERR6913134 211
akarlsson ERR6913200 826
akarlsson ERR6913227 1114
akarlsson ERR6913228 2007
akarlsson ERR6913229 1239
akarlsson ERR6913230 947
eahlberg ERR6913126 614
eahlberg ERR6913222 417
eahlberg ERR6913295 256
eahlberg ERR6913298 201
eahlberg ERR6913299 275
eahlberg ERR6913324 256
eahlberg ERR6913327 497
eahlberg ERR6913328 609
elahtinen ERR6913106 251
elahtinen ERR6913121 114
elahtinen ERR6913135 428
elahtinen ERR6913202 254
elahtinen ERR6913217 136
elahtinen ERR6913231 827
elahtinen ERR6913297 703
elahtinen ERR6913326 667
huiyu ERR6913156 10
huiyu ERR6913158 645
huiyu ERR6913168 27
huiyu ERR6913169 26
huiyu ERR6913252 12
huiyu ERR6913254 74
huiyu ERR6913264 10
huiyu ERR6913265 20
lhohmann ERR6913183 1657
lhohmann ERR6913184 1111
lhohmann ERR6913185 212
lhohmann ERR6913186 1585
lhohmann ERR6913279 714
lhohmann ERR6913280 557
lhohmann ERR6913281 1367
lhohmann ERR6913282 1784
linastep ERR6913147 384
linastep ERR6913154 10
linastep ERR6913157 32
linastep ERR6913165 37
linastep ERR6913243 665
linastep ERR6913250 20
linastep ERR6913253 21
linastep ERR6913261 7
llindquist ERR6913140 663
llindquist ERR6913191 206
llindquist ERR6913193 290
llindquist ERR6913195 559
llindquist ERR6913236 901
llindquist ERR6913287 723
llindquist ERR6913289 494
llindquist ERR6913291 645
mmiari ERR6913102 62
mmiari ERR6913187 280
mmiari ERR6913188 1415
mmiari ERR6913189 1811
mmiari ERR6913283 373
mmiari ERR6913284 1411
mmiari ERR6913285 1593
mtronstad ERR6913101 754
mtronstad ERR6913179 1001
mtronstad ERR6913180 1906
mtronstad ERR6913181 706
mtronstad ERR6913182 1191
mtronstad ERR6913197 1056
mtronstad ERR6913275 410
mtronstad ERR6913276 4968
mtronstad ERR6913277 1560
mtronstad ERR6913278 1020
phingamp ERR6913174 386
phingamp ERR6913175 1188
phingamp ERR6913176 4092
phingamp ERR6913177 4789
phingamp ERR6913178 3322
phingamp ERR6913270 1011
phingamp ERR6913271 1005
phingamp ERR6913272 143
phingamp ERR6913273 61
phingamp ERR6913274 88
pkalogeropoulos ERR6913114 57
pkalogeropoulos ERR6913123 114
pkalogeropoulos ERR6913124 72
pkalogeropoulos ERR6913155 13
pkalogeropoulos ERR6913210 90
pkalogeropoulos ERR6913219 136
pkalogeropoulos ERR6913220 59
pkalogeropoulos ERR6913251 12
rfeeney ERR6913312 1021
rfeeney ERR6913314 319
rfeeney ERR6913315 650
rfeeney ERR6913316 828
rfeeney ERR6913341 1122
rfeeney ERR6913343 702
rfeeney ERR6913344 846
rfeeney ERR6913345 1050
rgrochowski ERR6913112 81
rgrochowski ERR6913113 153
rgrochowski ERR6913122 459
rgrochowski ERR6913208 37
rgrochowski ERR6913209 33
rgrochowski ERR6913218 182
rgrochowski ERR6913320 1313
rgrochowski ERR6913349 480
rpotter ERR6913108 22
rpotter ERR6913116 22
rpotter ERR6913118 141
rpotter ERR6913136 530
rpotter ERR6913204 24
rpotter ERR6913212 7
rpotter ERR6913214 63
rpotter ERR6913232 1209
snarrowe ERR6913103 13
snarrowe ERR6913111 7
snarrowe ERR6913115 1
snarrowe ERR6913117 8
snarrowe ERR6913128 237
snarrowe ERR6913199 3
snarrowe ERR6913207 3
snarrowe ERR6913211 4
snarrowe ERR6913213 5
snarrowe ERR6913224 143
sqlite3 -batch /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db \
'SELECT * FROM bracken_abundances_long LIMIT 5;'
run_accession taxon_name taxonomy_id taxonomy_lvl kraken_assigned_reads added_reads new_est_reads fraction_total_reads ------------- -------------------------------- ----------- ------------ --------------------- ----------- ------------- -------------------- ERR6913112 Streptococcus oralis 1303 S 315 139 454 0.04101 ERR6913112 Streptococcus sp. LPB0220 2610896 S 64 14 78 0.00705 ERR6913112 Streptococcus sp. HSISM1 1316408 S 50 10 60 0.00542 ERR6913112 Streptococcus sp. oral taxon 064 712624 S 14 21 35 0.00316 ERR6913112 Streptococcus sp. oral taxon 061 712623 S 11 1 12 0.00108
sqlite3 -box -batch /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db \
'SELECT sample_name,total_reads,nonhost_reads FROM SampleOverviews LIMIT 5;'
┌───────────────────┬─────────────┬───────────────┐ │ sample_name │ total_reads │ nonhost_reads │ ├───────────────────┼─────────────┼───────────────┤ │ P011_DNA_S39_L001 │ 27630988 │ 102524 │ │ P312_DNA_S28_L001 │ 16206168 │ 151202 │ │ P306_DNA_S85_L001 │ 20868084 │ 539076 │ │ P276_DNA_S26_L001 │ 26596212 │ 729230 │ │ P272_DNA_S40_L001 │ 24205196 │ 397186 │ └───────────────────┴─────────────┴───────────────┘
cd ..
pwd
/shared/projects/2314_medbioinfo/hui/MedBioinfo23
sqlite3 -box -batch /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db \
'SELECT run_accession, sum(new_est_reads) AS total_reads,sum(fraction_total_reads) AS total_fraction, count(*) AS nb FROM bracken_abundances_long GROUP BY run_accession;'
┌───────────────┬─────────────┬───────────────────┬──────┐ │ run_accession │ total_reads │ total_fraction │ nb │ ├───────────────┼─────────────┼───────────────────┼──────┤ │ ERR6913101 │ 120450 │ 0.996980000000002 │ 754 │ │ ERR6913102 │ 6547 │ 0.995269999999999 │ 62 │ │ ERR6913103 │ 798 │ 0.99008 │ 13 │ │ ERR6913104 │ 167654 │ 0.998400000000002 │ 645 │ │ ERR6913106 │ 365105 │ 0.99967 │ 251 │ │ ERR6913107 │ 6922 │ 0.9977 │ 39 │ │ ERR6913108 │ 2224 │ 0.9964 │ 22 │ │ ERR6913109 │ 8030 │ 0.99193 │ 148 │ │ ERR6913111 │ 259 │ 0.98855 │ 7 │ │ ERR6913112 │ 11038 │ 0.99706 │ 81 │ │ ERR6913113 │ 10511 │ 0.992139999999999 │ 153 │ │ ERR6913114 │ 8695 │ 0.99702 │ 57 │ │ ERR6913115 │ 79 │ 1.0 │ 1 │ │ ERR6913116 │ 2085 │ 0.99427 │ 22 │ │ ERR6913117 │ 588 │ 0.99325 │ 8 │ │ ERR6913118 │ 37316 │ 0.99824 │ 141 │ │ ERR6913120 │ 4534 │ 0.99409 │ 56 │ │ ERR6913121 │ 9853 │ 0.994180000000001 │ 114 │ │ ERR6913122 │ 174203 │ 0.998660000000001 │ 459 │ │ ERR6913123 │ 18415 │ 0.99718 │ 114 │ │ ERR6913124 │ 19245 │ 0.99848 │ 72 │ │ ERR6913125 │ 1372 │ 0.99493 │ 13 │ │ ERR6913126 │ 55648 │ 0.994610000000001 │ 614 │ │ ERR6913128 │ 413755 │ 0.999729999999999 │ 237 │ │ ERR6913131 │ 925278 │ 1.00044999999999 │ 797 │ │ ERR6913132 │ 695110 │ 0.999159999999985 │ 1506 │ │ ERR6913133 │ 513470 │ 0.997829999999991 │ 2196 │ │ ERR6913134 │ 68210 │ 0.998759999999999 │ 211 │ │ ERR6913135 │ 914437 │ 0.999749999999999 │ 428 │ │ ERR6913136 │ 869839 │ 0.999609999999999 │ 530 │ │ ERR6913137 │ 850617 │ 0.999600000000001 │ 819 │ │ ERR6913138 │ 821002 │ 1.00005999999999 │ 1381 │ │ ERR6913139 │ 758566 │ 0.999589999999999 │ 620 │ │ ERR6913140 │ 782977 │ 0.999589999999999 │ 663 │ │ ERR6913145 │ 212601 │ 0.99944 │ 269 │ │ ERR6913146 │ 149287 │ 0.999420000000001 │ 174 │ │ ERR6913147 │ 836305 │ 0.99985 │ 384 │ │ ERR6913154 │ 15464 │ 0.99981 │ 10 │ │ ERR6913155 │ 969 │ 0.99281 │ 13 │ │ ERR6913156 │ 872 │ 0.99543 │ 10 │ │ ERR6913157 │ 2881 │ 0.99447 │ 32 │ │ ERR6913158 │ 36491 │ 0.991890000000002 │ 645 │ │ ERR6913159 │ 719 │ 0.99308 │ 9 │ │ ERR6913161 │ 6543 │ 0.99249 │ 105 │ │ ERR6913164 │ 5041 │ 0.98919 │ 116 │ │ ERR6913165 │ 6626 │ 0.99712 │ 37 │ │ ERR6913166 │ 9277 │ 0.99349 │ 118 │ │ ERR6913168 │ 5153 │ 0.99767 │ 27 │ │ ERR6913169 │ 5120 │ 0.99747 │ 26 │ │ ERR6913170 │ 2507 │ 0.99602 │ 29 │ │ ERR6913171 │ 10870 │ 0.99662 │ 81 │ │ ERR6913172 │ 54115 │ 0.98870000000001 │ 1348 │ │ ERR6913173 │ 4335 │ 0.99767 │ 23 │ │ ERR6913174 │ 21023 │ 0.99102 │ 386 │ │ ERR6913175 │ 35561 │ 0.984209999999999 │ 1188 │ │ ERR6913176 │ 113264 │ 0.982000000000004 │ 4092 │ │ ERR6913177 │ 144762 │ 0.982870000000005 │ 4789 │ │ ERR6913178 │ 84008 │ 0.982620000000004 │ 3322 │ │ ERR6913179 │ 664245 │ 0.999719999999995 │ 1001 │ │ ERR6913180 │ 682845 │ 0.998659999999984 │ 1906 │ │ ERR6913181 │ 967396 │ 1.00030999999999 │ 706 │ │ ERR6913182 │ 686889 │ 0.999359999999983 │ 1191 │ │ ERR6913183 │ 801894 │ 0.999449999999961 │ 1656 │ │ ERR6913184 │ 720548 │ 0.99966999999998 │ 1110 │ │ ERR6913185 │ 68208 │ 0.99879 │ 211 │ │ ERR6913186 │ 765749 │ 0.999589999999977 │ 1584 │ │ ERR6913187 │ 93044 │ 0.99875 │ 280 │ │ ERR6913188 │ 795467 │ 1.00018999999998 │ 1415 │ │ ERR6913189 │ 680246 │ 0.998559999999966 │ 1811 │ │ ERR6913191 │ 93173 │ 0.999 │ 206 │ │ ERR6913193 │ 341647 │ 0.999579999999999 │ 290 │ │ ERR6913195 │ 621320 │ 0.999680000000001 │ 559 │ │ ERR6913197 │ 222126 │ 0.997699999999999 │ 1056 │ │ ERR6913199 │ 580 │ 1.0 │ 3 │ │ ERR6913200 │ 633562 │ 0.999439999999998 │ 826 │ │ ERR6913202 │ 606099 │ 0.999770000000001 │ 254 │ │ ERR6913203 │ 5996 │ 0.9977 │ 28 │ │ ERR6913204 │ 14090 │ 0.99915 │ 24 │ │ ERR6913205 │ 381483 │ 0.99925 │ 687 │ │ ERR6913207 │ 165 │ 0.98802 │ 3 │ │ ERR6913208 │ 45738 │ 0.99964 │ 37 │ │ ERR6913209 │ 3169 │ 0.99432 │ 33 │ │ ERR6913210 │ 14819 │ 0.99701 │ 90 │ │ ERR6913211 │ 521 │ 1.00001 │ 4 │ │ ERR6913212 │ 627 │ 0.99523 │ 7 │ │ ERR6913213 │ 242 │ 0.99588 │ 5 │ │ ERR6913214 │ 11758 │ 0.99721 │ 63 │ │ ERR6913215 │ 10646 │ 0.9967 │ 74 │ │ ERR6913216 │ 10008 │ 0.99889 │ 21 │ │ ERR6913217 │ 30273 │ 0.99796 │ 136 │ │ ERR6913218 │ 89527 │ 0.99909 │ 182 │ │ ERR6913219 │ 271498 │ 0.99972 │ 136 │ │ ERR6913220 │ 37159 │ 0.99918 │ 59 │ │ ERR6913221 │ 5897 │ 0.99845 │ 23 │ │ ERR6913222 │ 576327 │ 0.999709999999999 │ 417 │ │ ERR6913224 │ 117677 │ 0.99944 │ 143 │ │ ERR6913227 │ 1185215 │ 0.99993999999999 │ 1114 │ │ ERR6913228 │ 822575 │ 1.00001999999997 │ 2007 │ │ ERR6913229 │ 1128230 │ 1.00001999999999 │ 1239 │ │ ERR6913230 │ 235388 │ 0.998479999999996 │ 947 │ │ ERR6913231 │ 1137573 │ 0.999539999999992 │ 827 │ │ ERR6913232 │ 1287895 │ 0.99941999999999 │ 1209 │ │ ERR6913233 │ 1471682 │ 0.999309999999977 │ 1614 │ │ ERR6913234 │ 1215969 │ 0.999429999999986 │ 1334 │ │ ERR6913235 │ 928408 │ 0.99938 │ 1226 │ │ ERR6913236 │ 1425266 │ 0.999869999999996 │ 901 │ │ ERR6913241 │ 1180170 │ 0.999539999999996 │ 998 │ │ ERR6913242 │ 696544 │ 0.998490000000002 │ 1972 │ │ ERR6913243 │ 1273155 │ 0.999759999999995 │ 665 │ │ ERR6913250 │ 83257 │ 0.99988 │ 20 │ │ ERR6913251 │ 998 │ 0.99502 │ 12 │ │ ERR6913252 │ 7546 │ 0.99933 │ 12 │ │ ERR6913253 │ 2468 │ 0.99596 │ 21 │ │ ERR6913254 │ 7471 │ 0.995350000000001 │ 74 │ │ ERR6913255 │ 754 │ 0.99603 │ 5 │ │ ERR6913257 │ 14486 │ 0.99781 │ 68 │ │ ERR6913260 │ 1645 │ 0.99516 │ 24 │ │ ERR6913261 │ 719 │ 0.99585 │ 7 │ │ ERR6913262 │ 12138 │ 0.99919 │ 21 │ │ ERR6913264 │ 5010 │ 0.9994 │ 10 │ │ ERR6913265 │ 1698 │ 0.99473 │ 20 │ │ ERR6913266 │ 1883 │ 0.9968 │ 18 │ │ ERR6913267 │ 4922 │ 0.99431 │ 57 │ │ ERR6913268 │ 45274 │ 0.988810000000001 │ 1064 │ │ ERR6913269 │ 11949 │ 0.99983 │ 7 │ │ ERR6913270 │ 49731 │ 0.991479999999999 │ 1011 │ │ ERR6913271 │ 473521 │ 0.998809999999997 │ 1005 │ │ ERR6913272 │ 23210 │ 0.997180000000001 │ 143 │ │ ERR6913273 │ 1956 │ 0.98297 │ 61 │ │ ERR6913274 │ 4753 │ 0.99164 │ 88 │ │ ERR6913275 │ 266886 │ 0.999210000000001 │ 410 │ │ ERR6913276 │ 906867 │ 0.999619999999931 │ 4968 │ │ ERR6913277 │ 1231583 │ 0.999619999999971 │ 1560 │ │ ERR6913278 │ 1273587 │ 0.999619999999994 │ 1020 │ │ ERR6913279 │ 1453824 │ 0.999759999999994 │ 713 │ │ ERR6913280 │ 1436016 │ 0.999749999999999 │ 556 │ │ ERR6913281 │ 1094958 │ 0.999869999999993 │ 1366 │ │ ERR6913282 │ 1091047 │ 1.00014999999997 │ 1783 │ │ ERR6913283 │ 110183 │ 0.99839 │ 373 │ │ ERR6913284 │ 925913 │ 1.00047999999998 │ 1411 │ │ ERR6913285 │ 883552 │ 1.00014999999997 │ 1593 │ │ ERR6913287 │ 1044802 │ 0.99976 │ 723 │ │ ERR6913289 │ 1008634 │ 0.999679999999998 │ 494 │ │ ERR6913291 │ 1202323 │ 0.999399999999996 │ 645 │ │ ERR6913293 │ 180024 │ 0.9984 │ 627 │ │ ERR6913294 │ 521475 │ 0.999230000000001 │ 644 │ │ ERR6913295 │ 26672 │ 0.995650000000001 │ 256 │ │ ERR6913296 │ 566661 │ 0.998909999999997 │ 1158 │ │ ERR6913297 │ 708138 │ 0.99958 │ 703 │ │ ERR6913298 │ 42228 │ 0.99792 │ 201 │ │ ERR6913299 │ 132195 │ 0.999049999999999 │ 275 │ │ ERR6913302 │ 170133 │ 0.999040000000001 │ 420 │ │ ERR6913304 │ 312336 │ 0.999840000000001 │ 155 │ │ ERR6913305 │ 644761 │ 0.999629999999999 │ 566 │ │ ERR6913306 │ 255016 │ 0.999450000000001 │ 277 │ │ ERR6913307 │ 423253 │ 0.99956 │ 329 │ │ ERR6913308 │ 774422 │ 0.999849999999999 │ 331 │ │ ERR6913312 │ 194002 │ 0.998549999999997 │ 1021 │ │ ERR6913313 │ 822077 │ 0.99983 │ 314 │ │ ERR6913314 │ 1042806 │ 0.999859999999996 │ 319 │ │ ERR6913315 │ 159602 │ 0.998430000000001 │ 650 │ │ ERR6913316 │ 122645 │ 0.997480000000001 │ 828 │ │ ERR6913320 │ 522400 │ 0.998389999999999 │ 1313 │ │ ERR6913322 │ 1184330 │ 0.999889999999998 │ 475 │ │ ERR6913323 │ 828544 │ 0.99959 │ 711 │ │ ERR6913324 │ 26672 │ 0.995650000000001 │ 256 │ │ ERR6913325 │ 660086 │ 0.999249999999989 │ 1271 │ │ ERR6913326 │ 902722 │ 0.999670000000001 │ 667 │ │ ERR6913327 │ 462986 │ 0.999439999999999 │ 497 │ │ ERR6913328 │ 151456 │ 0.998180000000001 │ 609 │ │ ERR6913331 │ 211684 │ 0.998329999999998 │ 752 │ │ ERR6913333 │ 885904 │ 0.999899999999991 │ 542 │ │ ERR6913334 │ 774382 │ 0.99972 │ 353 │ │ ERR6913335 │ 727340 │ 0.99959 │ 355 │ │ ERR6913336 │ 314974 │ 0.99965 │ 237 │ │ ERR6913337 │ 1471167 │ 0.99989 │ 284 │ │ ERR6913341 │ 997919 │ 1.00039999999999 │ 1122 │ │ ERR6913342 │ 1835085 │ 1.00012 │ 437 │ │ ERR6913343 │ 1714397 │ 0.999889999999995 │ 702 │ │ ERR6913344 │ 1139978 │ 0.999689999999992 │ 846 │ │ ERR6913345 │ 1108074 │ 0.99961999999999 │ 1050 │ │ ERR6913349 │ 1504874 │ 0.999939999999998 │ 480 │ └───────────────┴─────────────┴───────────────────┴──────┘
sqlite3 -box -batch /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db \
'SELECT run_accession,taxon_name,taxonomy_id,new_est_reads,fraction_total_reads AS fraction
FROM bracken_abundances_long
WHERE taxon_name LIKE "%corona%"
ORDER BY fraction_total_reads DESC;'
┌───────────────┬───────────────────────────────────────────────────────┬─────────────┬───────────────┬──────────┐ │ run_accession │ taxon_name │ taxonomy_id │ new_est_reads │ fraction │ ├───────────────┼───────────────────────────────────────────────────────┼─────────────┼───────────────┼──────────┤ │ ERR6913216 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 7797 │ 0.77822 │ │ ERR6913199 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 439 │ 0.7569 │ │ ERR6913221 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 4360 │ 0.73823 │ │ ERR6913210 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 6142 │ 0.41324 │ │ ERR6913214 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 4573 │ 0.38784 │ │ ERR6913211 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 150 │ 0.28791 │ │ ERR6913215 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 2365 │ 0.22142 │ │ ERR6913203 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 1318 │ 0.2193 │ │ ERR6913217 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 5938 │ 0.19576 │ │ ERR6913204 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 2468 │ 0.17501 │ │ ERR6913219 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 11656 │ 0.04292 │ │ ERR6913213 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 10 │ 0.04115 │ │ ERR6913197 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 8980 │ 0.04034 │ │ ERR6913212 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 23 │ 0.03651 │ │ ERR6913261 │ Human coronavirus NL63 │ 277944 │ 21 │ 0.02909 │ │ ERR6913208 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 968 │ 0.02116 │ │ ERR6913220 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 736 │ 0.01979 │ │ ERR6913218 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 1532 │ 0.0171 │ │ ERR6913252 │ Human coronavirus HKU1 │ 290028 │ 80 │ 0.01059 │ │ ERR6913121 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 77 │ 0.00777 │ │ ERR6913209 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 24 │ 0.00753 │ │ ERR6913200 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 4760 │ 0.00751 │ │ ERR6913327 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 1484 │ 0.0032 │ │ ERR6913267 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 12 │ 0.00242 │ │ ERR6913254 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 17 │ 0.00226 │ │ ERR6913330 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 879 │ 0.00159 │ │ ERR6913268 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 64 │ 0.0014 │ │ ERR6913126 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 76 │ 0.00136 │ │ ERR6913101 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 128 │ 0.00106 │ │ ERR6913329 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 307 │ 0.00102 │ │ ERR6913326 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 828 │ 0.00092 │ │ ERR6913328 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 104 │ 0.00069 │ │ ERR6913275 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 168 │ 0.00063 │ │ ERR6913122 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 92 │ 0.00053 │ │ ERR6913315 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 84 │ 0.00053 │ │ ERR6913331 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 100 │ 0.00047 │ │ ERR6913305 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 298 │ 0.00046 │ │ ERR6913293 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 79 │ 0.00044 │ │ ERR6913322 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 517 │ 0.00044 │ │ ERR6913226 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 428 │ 0.00035 │ │ ERR6913230 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 76 │ 0.00032 │ │ ERR6913233 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 444 │ 0.0003 │ │ ERR6913205 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 87 │ 0.00023 │ │ ERR6913312 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 39 │ 0.0002 │ │ ERR6913295 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 5 │ 0.00019 │ │ ERR6913324 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 5 │ 0.00019 │ │ ERR6913223 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 105 │ 0.00019 │ │ ERR6913104 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 29 │ 0.00017 │ │ ERR6913334 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 101 │ 0.00013 │ │ ERR6913202 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 55 │ 9.0e-05 │ │ ERR6913332 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 90 │ 8.0e-05 │ │ ERR6913242 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 50 │ 7.0e-05 │ │ ERR6913333 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 43 │ 5.0e-05 │ │ ERR6913276 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 26 │ 3.0e-05 │ │ ERR6913276 │ Pseudomonas coronafaciens │ 53409 │ 21 │ 2.0e-05 │ │ ERR6913222 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 13 │ 2.0e-05 │ │ ERR6913306 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 6 │ 2.0e-05 │ │ ERR6913345 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 26 │ 2.0e-05 │ │ ERR6913325 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 10 │ 2.0e-05 │ │ ERR6913313 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 13 │ 2.0e-05 │ │ ERR6913342 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 34 │ 2.0e-05 │ │ ERR6913323 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 20 │ 2.0e-05 │ │ ERR6913271 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 6 │ 1.0e-05 │ │ ERR6913307 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 5 │ 1.0e-05 │ │ ERR6913343 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 11 │ 1.0e-05 │ │ ERR6913228 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 5 │ 1.0e-05 │ │ ERR6913196 │ Pseudomonas coronafaciens │ 53409 │ 7 │ 1.0e-05 │ │ ERR6913344 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 5 │ 0.0 │ │ ERR6913194 │ Pseudomonas coronafaciens │ 53409 │ 2 │ 0.0 │ │ ERR6913225 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 1 │ 0.0 │ │ ERR6913290 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 2 │ 0.0 │ │ ERR6913292 │ Severe acute respiratory syndrome-related coronavirus │ 694009 │ 2 │ 0.0 │ └───────────────┴───────────────────────────────────────────────────────┴─────────────┴───────────────┴──────────┘
sqlite3 -box -batch /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db \
'SELECT run_accession,taxon_name,new_est_reads,fraction_total_reads AS fraction
FROM bracken_abundances_long
WHERE taxon_name LIKE "%human%"
ORDER BY fraction_total_reads DESC;'
┌───────────────┬──────────────────────────┬───────────────┬──────────┐ │ run_accession │ taxon_name │ new_est_reads │ fraction │ ├───────────────┼──────────────────────────┼───────────────┼──────────┤ │ ERR6913261 │ Human coronavirus NL63 │ 21 │ 0.02909 │ │ ERR6913109 │ Human betaherpesvirus 6B │ 161 │ 0.01989 │ │ ERR6913252 │ Human coronavirus HKU1 │ 80 │ 0.01059 │ │ ERR6913260 │ Human mastadenovirus C │ 11 │ 0.00665 │ │ ERR6913254 │ Human mastadenovirus C │ 38 │ 0.00506 │ │ ERR6913273 │ Human mastadenovirus C │ 9 │ 0.00452 │ │ ERR6913267 │ Human mastadenovirus C │ 15 │ 0.00303 │ │ ERR6913268 │ Human mastadenovirus C │ 136 │ 0.00297 │ │ ERR6913272 │ Human betaherpesvirus 6B │ 69 │ 0.00296 │ │ ERR6913187 │ Human betaherpesvirus 6B │ 169 │ 0.00181 │ │ ERR6913274 │ Human mastadenovirus C │ 7 │ 0.00146 │ │ ERR6913283 │ Human betaherpesvirus 6B │ 159 │ 0.00144 │ │ ERR6913272 │ Human mastadenovirus C │ 28 │ 0.0012 │ │ ERR6913112 │ Human gammaherpesvirus 4 │ 12 │ 0.00108 │ │ ERR6913210 │ Human mastadenovirus C │ 16 │ 0.00108 │ │ ERR6913176 │ Human betaherpesvirus 6B │ 107 │ 0.00093 │ │ ERR6913276 │ Human mastadenovirus C │ 687 │ 0.00076 │ │ ERR6913180 │ Bacteroides humanifaecis │ 356 │ 0.00052 │ │ ERR6913295 │ Human mastadenovirus C │ 14 │ 0.00052 │ │ ERR6913324 │ Human mastadenovirus C │ 14 │ 0.00052 │ │ ERR6913106 │ Human gammaherpesvirus 4 │ 179 │ 0.00049 │ │ ERR6913270 │ Human mastadenovirus C │ 23 │ 0.00046 │ │ ERR6913306 │ Human gammaherpesvirus 4 │ 111 │ 0.00044 │ │ ERR6913217 │ Human mastadenovirus C │ 13 │ 0.00043 │ │ ERR6913328 │ Human mastadenovirus C │ 44 │ 0.00029 │ │ ERR6913323 │ Human mastadenovirus C │ 148 │ 0.00018 │ │ ERR6913196 │ Human betaherpesvirus 6B │ 134 │ 0.00017 │ │ ERR6913327 │ Human mastadenovirus C │ 63 │ 0.00014 │ │ ERR6913189 │ Bacteroides humanifaecis │ 79 │ 0.00012 │ │ ERR6913202 │ Human gammaherpesvirus 4 │ 71 │ 0.00012 │ │ ERR6913282 │ Human mastadenovirus C │ 112 │ 0.0001 │ │ ERR6913205 │ Human betaherpesvirus 6B │ 39 │ 0.0001 │ │ ERR6913194 │ Bacteroides humanifaecis │ 49 │ 9.0e-05 │ │ ERR6913283 │ Human mastadenovirus C │ 8 │ 7.0e-05 │ │ ERR6913335 │ Human gammaherpesvirus 4 │ 42 │ 6.0e-05 │ │ ERR6913283 │ Human betaherpesvirus 7 │ 6 │ 5.0e-05 │ │ ERR6913196 │ Bacteroides humanifaecis │ 41 │ 5.0e-05 │ │ ERR6913101 │ Human gammaherpesvirus 4 │ 5 │ 4.0e-05 │ │ ERR6913197 │ Human mastadenovirus C │ 8 │ 4.0e-05 │ │ ERR6913230 │ Human mastadenovirus C │ 10 │ 4.0e-05 │ │ ERR6913197 │ Human gammaherpesvirus 4 │ 6 │ 3.0e-05 │ │ ERR6913275 │ Human mastadenovirus C │ 8 │ 3.0e-05 │ │ ERR6913277 │ Human mastadenovirus C │ 33 │ 3.0e-05 │ │ ERR6913271 │ Human mastadenovirus C │ 16 │ 3.0e-05 │ │ ERR6913232 │ Human mastadenovirus C │ 38 │ 3.0e-05 │ │ ERR6913138 │ Human gammaherpesvirus 4 │ 21 │ 3.0e-05 │ │ ERR6913333 │ Human mastadenovirus C │ 23 │ 3.0e-05 │ │ ERR6913139 │ Human gammaherpesvirus 4 │ 21 │ 3.0e-05 │ │ ERR6913233 │ Human mastadenovirus C │ 50 │ 3.0e-05 │ │ ERR6913129 │ Human betaherpesvirus 7 │ 5 │ 3.0e-05 │ │ ERR6913287 │ Human mastadenovirus C │ 18 │ 2.0e-05 │ │ ERR6913281 │ Human mastadenovirus C │ 23 │ 2.0e-05 │ │ ERR6913345 │ Human mastadenovirus C │ 21 │ 2.0e-05 │ │ ERR6913225 │ Human mastadenovirus C │ 29 │ 2.0e-05 │ │ ERR6913349 │ Human mastadenovirus C │ 14 │ 1.0e-05 │ │ ERR6913285 │ Human mastadenovirus C │ 10 │ 1.0e-05 │ │ ERR6913326 │ Human mastadenovirus C │ 12 │ 1.0e-05 │ │ ERR6913183 │ Human gammaherpesvirus 4 │ 5 │ 1.0e-05 │ │ ERR6913305 │ Human betaherpesvirus 7 │ 8 │ 1.0e-05 │ │ ERR6913341 │ Human gammaherpesvirus 4 │ 5 │ 1.0e-05 │ │ ERR6913341 │ Human mastadenovirus C │ 5 │ 1.0e-05 │ │ ERR6913200 │ Human mastadenovirus C │ 6 │ 1.0e-05 │ │ ERR6913228 │ Human mastadenovirus C │ 9 │ 1.0e-05 │ │ ERR6913231 │ Human mastadenovirus C │ 15 │ 1.0e-05 │ │ ERR6913226 │ Human mastadenovirus C │ 17 │ 1.0e-05 │ │ ERR6913292 │ Human betaherpesvirus 6B │ 12 │ 1.0e-05 │ │ ERR6913234 │ Human mastadenovirus C │ 6 │ 0.0 │ │ ERR6913130 │ Human betaherpesvirus 7 │ 1 │ 0.0 │ │ ERR6913196 │ Human betaherpesvirus 7 │ 1 │ 0.0 │ │ ERR6913292 │ Human mastadenovirus C │ 2 │ 0.0 │ └───────────────┴──────────────────────────┴───────────────┴──────────┘
sqlite3 -batch /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db \
'SELECT * FROM CtValues LIMIT 2;'
Blinded_number Ct -------------- --- P105 0.0 P113 0.0
sqlite3 -batch /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db \
'SELECT * FROM sample_annot LIMIT 2;'
run_accession host_subject_id patient_code nuc host_body_site host_disease_status miscellaneous_parameter Ct total_reads read_count base_count ------------- ----------------- ------------ --- -------------- ------------------- ------------------------- ----- ----------- ---------- ---------- ERR6913102 P011_DNA_S39_L001 P11 DNA Nasopharyngeal SARS-CoV-2 positive Symptomatic-DNA-sequenced 23.59 27630988 102524 13193813 ERR6913103 P019_DNA_S74_L001 P19 DNA Nasopharyngeal SARS-CoV-2 positive Symptomatic-DNA-sequenced 18.81 21364260 385740 49060845
sqlite3 -box -batch /shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db \
'SELECT run_accession,taxon_name,new_est_reads AS reads,fraction_total_reads AS fraction, nuc, host_disease_status, total_reads, read_count, Ct
FROM bracken_abundances_long abu LEFT JOIN sample_annot spl using (run_accession)
WHERE taxon_name LIKE "%corona%"
ORDER BY fraction_total_reads DESC;'
┌───────────────┬───────────────────────────────────────────────────────┬───────┬──────────┬─────┬─────────────────────┬─────────────┬────────────┬───────┐ │ run_accession │ taxon_name │ reads │ fraction │ nuc │ host_disease_status │ total_reads │ read_count │ Ct │ ├───────────────┼───────────────────────────────────────────────────────┼───────┼──────────┼─────┼─────────────────────┼─────────────┼────────────┼───────┤ │ ERR6913216 │ Severe acute respiratory syndrome-related coronavirus │ 7797 │ 0.77822 │ RNA │ SARS-CoV-2 positive │ 17198782 │ 39552 │ 17.99 │ │ ERR6913199 │ Severe acute respiratory syndrome-related coronavirus │ 439 │ 0.7569 │ RNA │ SARS-CoV-2 positive │ 20758064 │ 62396 │ 18.81 │ │ ERR6913221 │ Severe acute respiratory syndrome-related coronavirus │ 4360 │ 0.73823 │ RNA │ SARS-CoV-2 positive │ 19171612 │ 23570 │ 17.88 │ │ ERR6913210 │ Severe acute respiratory syndrome-related coronavirus │ 6142 │ 0.41324 │ RNA │ SARS-CoV-2 positive │ 21965834 │ 107788 │ 19.52 │ │ ERR6913214 │ Severe acute respiratory syndrome-related coronavirus │ 4573 │ 0.38784 │ RNA │ SARS-CoV-2 positive │ 21508942 │ 79318 │ 17.81 │ │ ERR6913211 │ Severe acute respiratory syndrome-related coronavirus │ 150 │ 0.28791 │ RNA │ SARS-CoV-2 positive │ 17691576 │ 39562 │ 19.63 │ │ ERR6913215 │ Severe acute respiratory syndrome-related coronavirus │ 2365 │ 0.22142 │ RNA │ SARS-CoV-2 positive │ 17125668 │ 84944 │ 18.89 │ │ ERR6913203 │ Severe acute respiratory syndrome-related coronavirus │ 1318 │ 0.2193 │ RNA │ SARS-CoV-2 positive │ 22052590 │ 31944 │ 19.38 │ │ ERR6913217 │ Severe acute respiratory syndrome-related coronavirus │ 5938 │ 0.19576 │ RNA │ SARS-CoV-2 positive │ 20352976 │ 203098 │ 17.56 │ │ ERR6913204 │ Severe acute respiratory syndrome-related coronavirus │ 2468 │ 0.17501 │ RNA │ SARS-CoV-2 positive │ 27571556 │ 47600 │ 18.42 │ │ ERR6913219 │ Severe acute respiratory syndrome-related coronavirus │ 11656 │ 0.04292 │ RNA │ SARS-CoV-2 positive │ 18437710 │ 615136 │ 17.93 │ │ ERR6913213 │ Severe acute respiratory syndrome-related coronavirus │ 10 │ 0.04115 │ RNA │ SARS-CoV-2 positive │ 26128248 │ 31868 │ 21.34 │ │ ERR6913197 │ Severe acute respiratory syndrome-related coronavirus │ 8980 │ 0.04034 │ RNA │ SARS-CoV-2 positive │ 27027782 │ 758080 │ 18.0 │ │ ERR6913212 │ Severe acute respiratory syndrome-related coronavirus │ 23 │ 0.03651 │ RNA │ SARS-CoV-2 positive │ 20644176 │ 6948 │ 23.43 │ │ ERR6913261 │ Human coronavirus NL63 │ 21 │ 0.02909 │ RNA │ SARS-CoV-2 negative │ 24026306 │ 8410 │ 0.0 │ │ ERR6913208 │ Severe acute respiratory syndrome-related coronavirus │ 968 │ 0.02116 │ RNA │ SARS-CoV-2 positive │ 17354398 │ 109226 │ 19.95 │ │ ERR6913220 │ Severe acute respiratory syndrome-related coronavirus │ 736 │ 0.01979 │ RNA │ SARS-CoV-2 positive │ 18372966 │ 85976 │ 19.64 │ │ ERR6913218 │ Severe acute respiratory syndrome-related coronavirus │ 1532 │ 0.0171 │ RNA │ SARS-CoV-2 positive │ 21843848 │ 286382 │ 17.55 │ │ ERR6913252 │ Human coronavirus HKU1 │ 80 │ 0.01059 │ RNA │ SARS-CoV-2 negative │ 22690768 │ 19934 │ 0.0 │ │ ERR6913121 │ Severe acute respiratory syndrome-related coronavirus │ 77 │ 0.00777 │ DNA │ SARS-CoV-2 positive │ 19030318 │ 120658 │ 17.56 │ │ ERR6913209 │ Severe acute respiratory syndrome-related coronavirus │ 24 │ 0.00753 │ RNA │ SARS-CoV-2 positive │ 28082388 │ 28014 │ 23.92 │ │ ERR6913200 │ Severe acute respiratory syndrome-related coronavirus │ 4760 │ 0.00751 │ RNA │ SARS-CoV-2 positive │ 19148958 │ 1392334 │ 18.02 │ │ ERR6913327 │ Severe acute respiratory syndrome-related coronavirus │ 1484 │ 0.0032 │ RNA │ SARS-CoV-2 positive │ 12183696 │ 1119746 │ 23.37 │ │ ERR6913267 │ Severe acute respiratory syndrome-related coronavirus │ 12 │ 0.00242 │ RNA │ SARS-CoV-2 negative │ 21777586 │ 84794 │ 0.0 │ │ ERR6913254 │ Severe acute respiratory syndrome-related coronavirus │ 17 │ 0.00226 │ RNA │ SARS-CoV-2 negative │ 7605936 │ 99900 │ 0.0 │ │ ERR6913268 │ Severe acute respiratory syndrome-related coronavirus │ 64 │ 0.0014 │ RNA │ SARS-CoV-2 negative │ 18099096 │ 354056 │ 0.0 │ │ ERR6913126 │ Severe acute respiratory syndrome-related coronavirus │ 76 │ 0.00136 │ DNA │ SARS-CoV-2 positive │ 20908814 │ 731096 │ 17.28 │ │ ERR6913101 │ Severe acute respiratory syndrome-related coronavirus │ 128 │ 0.00106 │ DNA │ SARS-CoV-2 positive │ 20246544 │ 658268 │ 18.0 │ │ ERR6913326 │ Severe acute respiratory syndrome-related coronavirus │ 828 │ 0.00092 │ RNA │ SARS-CoV-2 positive │ 25509490 │ 2349534 │ 20.29 │ │ ERR6913328 │ Severe acute respiratory syndrome-related coronavirus │ 104 │ 0.00069 │ RNA │ SARS-CoV-2 positive │ 23559354 │ 1115208 │ 25.72 │ │ ERR6913275 │ Severe acute respiratory syndrome-related coronavirus │ 168 │ 0.00063 │ RNA │ SARS-CoV-2 negative │ 20429462 │ 606162 │ 27.65 │ │ ERR6913122 │ Severe acute respiratory syndrome-related coronavirus │ 92 │ 0.00053 │ DNA │ SARS-CoV-2 positive │ 19148784 │ 745326 │ 17.55 │ │ ERR6913315 │ Severe acute respiratory syndrome-related coronavirus │ 84 │ 0.00053 │ DNA │ SARS-CoV-2 negative │ 21468280 │ 746902 │ 0.0 │ │ ERR6913331 │ Severe acute respiratory syndrome-related coronavirus │ 100 │ 0.00047 │ RNA │ SARS-CoV-2 positive │ 23702012 │ 846014 │ 25.49 │ │ ERR6913305 │ Severe acute respiratory syndrome-related coronavirus │ 298 │ 0.00046 │ DNA │ SARS-CoV-2 negative │ 27251714 │ 1874096 │ 0.0 │ │ ERR6913293 │ Severe acute respiratory syndrome-related coronavirus │ 79 │ 0.00044 │ DNA │ SARS-CoV-2 positive │ 18338068 │ 823494 │ 17.53 │ │ ERR6913322 │ Severe acute respiratory syndrome-related coronavirus │ 517 │ 0.00044 │ RNA │ SARS-CoV-2 positive │ 11522192 │ 2441696 │ 17.53 │ │ ERR6913226 │ Severe acute respiratory syndrome-related coronavirus │ 428 │ 0.00035 │ RNA │ SARS-CoV-2 positive │ 18028410 │ 2732518 │ │ │ ERR6913230 │ Severe acute respiratory syndrome-related coronavirus │ 76 │ 0.00032 │ RNA │ SARS-CoV-2 positive │ 15306918 │ 626228 │ 23.01 │ │ ERR6913233 │ Severe acute respiratory syndrome-related coronavirus │ 444 │ 0.0003 │ RNA │ SARS-CoV-2 positive │ 12640954 │ 3469648 │ 26.37 │ │ ERR6913205 │ Severe acute respiratory syndrome-related coronavirus │ 87 │ 0.00023 │ RNA │ SARS-CoV-2 positive │ 21029778 │ 805170 │ 23.66 │ │ ERR6913312 │ Severe acute respiratory syndrome-related coronavirus │ 39 │ 0.0002 │ DNA │ SARS-CoV-2 negative │ 18705528 │ 1001132 │ 0.0 │ │ ERR6913295 │ Severe acute respiratory syndrome-related coronavirus │ 5 │ 0.00019 │ DNA │ SARS-CoV-2 positive │ 1449648 │ 203638 │ 25.64 │ │ ERR6913324 │ Severe acute respiratory syndrome-related coronavirus │ 5 │ 0.00019 │ RNA │ SARS-CoV-2 positive │ 1449648 │ 203638 │ 25.64 │ │ ERR6913104 │ Severe acute respiratory syndrome-related coronavirus │ 29 │ 0.00017 │ DNA │ SARS-CoV-2 positive │ 22910206 │ 610606 │ 18.02 │ │ ERR6913334 │ Severe acute respiratory syndrome-related coronavirus │ 101 │ 0.00013 │ RNA │ SARS-CoV-2 negative │ 20238122 │ 1736934 │ 0.0 │ │ ERR6913202 │ Severe acute respiratory syndrome-related coronavirus │ 55 │ 9.0e-05 │ RNA │ SARS-CoV-2 positive │ 21061776 │ 1416556 │ 19.59 │ │ ERR6913242 │ Severe acute respiratory syndrome-related coronavirus │ 50 │ 7.0e-05 │ RNA │ SARS-CoV-2 positive │ 24149962 │ 2583114 │ │ │ ERR6913333 │ Severe acute respiratory syndrome-related coronavirus │ 43 │ 5.0e-05 │ RNA │ SARS-CoV-2 positive │ 17030332 │ 1962584 │ 23.52 │ │ ERR6913276 │ Severe acute respiratory syndrome-related coronavirus │ 26 │ 3.0e-05 │ RNA │ SARS-CoV-2 negative │ 17780890 │ 3177948 │ 21.94 │ │ ERR6913276 │ Pseudomonas coronafaciens │ 21 │ 2.0e-05 │ RNA │ SARS-CoV-2 negative │ 17780890 │ 3177948 │ 21.94 │ │ ERR6913222 │ Severe acute respiratory syndrome-related coronavirus │ 13 │ 2.0e-05 │ RNA │ SARS-CoV-2 positive │ 24783540 │ 1834540 │ 17.28 │ │ ERR6913306 │ Severe acute respiratory syndrome-related coronavirus │ 6 │ 2.0e-05 │ DNA │ SARS-CoV-2 negative │ 18684426 │ 744842 │ 0.0 │ │ ERR6913345 │ Severe acute respiratory syndrome-related coronavirus │ 26 │ 2.0e-05 │ RNA │ SARS-CoV-2 negative │ 21714858 │ 2750394 │ 0.0 │ │ ERR6913325 │ Severe acute respiratory syndrome-related coronavirus │ 10 │ 2.0e-05 │ RNA │ SARS-CoV-2 positive │ 19664100 │ 1824222 │ 24.14 │ │ ERR6913313 │ Severe acute respiratory syndrome-related coronavirus │ 13 │ 2.0e-05 │ DNA │ SARS-CoV-2 negative │ 14895168 │ 2136132 │ 0.0 │ │ ERR6913342 │ Severe acute respiratory syndrome-related coronavirus │ 34 │ 2.0e-05 │ RNA │ SARS-CoV-2 negative │ 17613434 │ 3754758 │ 0.0 │ │ ERR6913323 │ Severe acute respiratory syndrome-related coronavirus │ 20 │ 2.0e-05 │ RNA │ SARS-CoV-2 positive │ 19424544 │ 3066570 │ 22.39 │ │ ERR6913271 │ Severe acute respiratory syndrome-related coronavirus │ 6 │ 1.0e-05 │ RNA │ SARS-CoV-2 negative │ 23805264 │ 1309086 │ │ │ ERR6913307 │ Severe acute respiratory syndrome-related coronavirus │ 5 │ 1.0e-05 │ DNA │ SARS-CoV-2 negative │ 20818628 │ 1250426 │ 0.0 │ │ ERR6913343 │ Severe acute respiratory syndrome-related coronavirus │ 11 │ 1.0e-05 │ RNA │ SARS-CoV-2 negative │ 41696524 │ 3478632 │ 0.0 │ │ ERR6913228 │ Severe acute respiratory syndrome-related coronavirus │ 5 │ 1.0e-05 │ RNA │ SARS-CoV-2 positive │ 21482936 │ 2298768 │ 25.21 │ │ ERR6913196 │ Pseudomonas coronafaciens │ 7 │ 1.0e-05 │ DNA │ SARS-CoV-2 negative │ 22682382 │ 2236474 │ 18.29 │ │ ERR6913344 │ Severe acute respiratory syndrome-related coronavirus │ 5 │ 0.0 │ RNA │ SARS-CoV-2 negative │ 22834560 │ 2380636 │ 0.0 │ │ ERR6913194 │ Pseudomonas coronafaciens │ 2 │ 0.0 │ DNA │ SARS-CoV-2 negative │ 18826866 │ 1386316 │ 27.0 │ │ ERR6913225 │ Severe acute respiratory syndrome-related coronavirus │ 1 │ 0.0 │ RNA │ SARS-CoV-2 positive │ 26601948 │ 2727870 │ 22.55 │ │ ERR6913290 │ Severe acute respiratory syndrome-related coronavirus │ 2 │ 0.0 │ RNA │ SARS-CoV-2 negative │ 22660356 │ 2558148 │ 27.0 │ │ ERR6913292 │ Severe acute respiratory syndrome-related coronavirus │ 2 │ 0.0 │ RNA │ SARS-CoV-2 negative │ 21276022 │ 2702312 │ 18.29 │ └───────────────┴───────────────────────────────────────────────────────┴───────┴──────────┴─────┴─────────────────────┴─────────────┴────────────┴───────┘
R session
library(DBI)
library(tidyverse)
Warning message in system("timedatectl", intern = TRUE):
“running command 'timedatectl' had status 1”
── Attaching packages ─────────────────────────────────────── tidyverse 1.3.1 ──
✔ ggplot2 3.3.5 ✔ purrr 0.3.4
✔ tibble 3.1.8 ✔ dplyr 1.0.7
✔ tidyr 1.1.4 ✔ stringr 1.4.0
✔ readr 2.1.0 ✔ forcats 0.5.1
── Conflicts ────────────────────────────────────────── tidyverse_conflicts() ──
✖ dplyr::filter() masks stats::filter()
✖ dplyr::lag() masks stats::lag()
mydb <- dbConnect(RSQLite::SQLite(), "/shared/projects/2314_medbioinfo/pascal/central_database/sample_collab.db")
options(tibble.width=200, tibble.print_max = 200, tibble.print_min = 5, width = 280, max.print=200,pillar.bold=TRUE, pillar.subtle=0, pillar.min_title_chars=7, pillar.sigfig=1)
abun_long <- as_tibble(dbGetQuery(mydb, "select * from bracken_abundances_long abu left join sample_annot spl using(run_accession);"))
abun_long
| run_accession | taxon_name | taxonomy_id | taxonomy_lvl | kraken_assigned_reads | added_reads | new_est_reads | fraction_total_reads | host_subject_id | patient_code | nuc | host_body_site | host_disease_status | miscellaneous_parameter | Ct | total_reads | read_count | base_count |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| <chr> | <chr> | <int> | <chr> | <int> | <int> | <int> | <dbl> | <chr> | <chr> | <chr> | <chr> | <chr> | <chr> | <dbl> | <int> | <int> | <int> |
| ERR6913112 | Streptococcus oralis | 1303 | S | 315 | 139 | 454 | 0.04101 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Streptococcus sp. LPB0220 | 2610896 | S | 64 | 14 | 78 | 0.00705 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Streptococcus sp. HSISM1 | 1316408 | S | 50 | 10 | 60 | 0.00542 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Streptococcus sp. oral taxon 064 | 712624 | S | 14 | 21 | 35 | 0.00316 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Streptococcus sp. oral taxon 061 | 712623 | S | 11 | 1 | 12 | 0.00108 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Streptococcus salivarius | 1304 | S | 171 | 60 | 231 | 0.02087 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Streptococcus mitis | 28037 | S | 135 | 24 | 159 | 0.01436 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Streptococcus intermedius | 1338 | S | 106 | 32 | 138 | 0.01246 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Streptococcus vestibularis | 1343 | S | 69 | 10 | 79 | 0.00714 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Streptococcus parasanguinis | 1318 | S | 59 | 9 | 68 | 0.00614 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Streptococcus gordonii | 1302 | S | 57 | 2 | 59 | 0.00533 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Streptococcus pneumoniae | 1313 | S | 25 | 17 | 42 | 0.00379 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Streptococcus mutans | 1309 | S | 24 | 1 | 25 | 0.00226 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Streptococcus infantis | 68892 | S | 21 | 2 | 23 | 0.00208 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Streptococcus gwangjuense | 1433513 | S | 17 | 5 | 22 | 0.00199 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Streptococcus pseudopneumoniae | 257758 | S | 11 | 3 | 14 | 0.00126 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Dolosigranulum pigrum | 29394 | S | 514 | 4 | 518 | 0.04679 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Granulicatella adiacens | 46124 | S | 21 | 0 | 21 | 0.00190 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Ligilactobacillus salivarius | 1624 | S | 103 | 10 | 113 | 0.01021 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Limosilactobacillus portuensis | 2742601 | S | 48 | 9 | 57 | 0.00515 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Limosilactobacillus fermentum | 1613 | S | 11 | 3 | 14 | 0.00126 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Lactobacillus gasseri | 1596 | S | 24 | 9 | 33 | 0.00298 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Lactobacillus crispatus | 47770 | S | 13 | 0 | 13 | 0.00117 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Enterococcus cecorum | 44008 | S | 47 | 1 | 48 | 0.00434 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Staphylococcus epidermidis | 1282 | S | 33 | 13 | 46 | 0.00415 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Veillonella parvula | 29466 | S | 240 | 5 | 245 | 0.02213 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Veillonella atypica | 39777 | S | 112 | 2 | 114 | 0.01030 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Veillonella nakazawae | 2682456 | S | 112 | 33 | 145 | 0.01310 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Veillonella dispar | 39778 | S | 78 | 10 | 88 | 0.00795 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ERR6913112 | Veillonella sp. S12025-13 | 2682455 | S | 65 | 15 | 80 | 0.00723 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
| ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ |
| ERR6913223 | Pseudomonas fluorescens | 294 | S | 17 | 96 | 113 | 0.00020 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Haemophilus parainfluenzae | 729 | S | 60 | 96 | 156 | 0.00028 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Xanthomonas campestris | 339 | S | 25 | 98 | 123 | 0.00022 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Stenotrophomonas maltophilia | 40324 | S | 18 | 24 | 42 | 0.00007 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Cardiobacterium hominis | 2718 | S | 16 | 8 | 24 | 0.00004 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Cardiobacterium sp. Marseille-Q4385 | 2866573 | S | 11 | 4 | 15 | 0.00003 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Lautropia mirabilis | 47671 | S | 79 | 86 | 165 | 0.00029 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Achromobacter deleyi | 1353891 | S | 13 | 27 | 40 | 0.00007 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Dechloromonas sp. A34 | 447588 | S | 30 | 11 | 41 | 0.00007 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Dechloromonas sp. TW-R-39-2 | 2654218 | S | 10 | 10 | 20 | 0.00004 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Dechloromonas denitrificans | 281362 | S | 33 | 16 | 49 | 0.00009 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Ferribacterium limneticum | 76259 | S | 78 | 28 | 106 | 0.00019 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Quatrionicoccus australiensis | 138118 | S | 26 | 17 | 43 | 0.00008 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Azospira oryzae | 146939 | S | 11 | 35 | 46 | 0.00008 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Kingella oralis | 505 | S | 11 | 149 | 160 | 0.00028 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Mesorhizobium terrae | 2725666 | S | 25 | 54 | 79 | 0.00014 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Methylobacterium sp. FF17 | 2984843 | S | 16 | 9 | 25 | 0.00004 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Novosphingobium sp. EMRT-2 | 2571749 | S | 26 | 44 | 70 | 0.00012 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Prevotella sp. oral taxon 475 | 712471 | S | 23 | 16 | 39 | 0.00007 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Prevotella sp. oral taxon 299 | 652716 | S | 17 | 26 | 43 | 0.00008 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Porphyromonas sp. oral taxon 275 | 712435 | S | 29 | 14 | 43 | 0.00008 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Capnocytophaga gingivalis | 1017 | S | 35 | 20 | 55 | 0.00010 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Capnocytophaga sputigena | 1019 | S | 32 | 52 | 84 | 0.00015 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Fusobacterium nucleatum | 851 | S | 24 | 126 | 150 | 0.00026 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Leptotrichia sp. oral taxon 212 | 712357 | S | 104 | 18 | 122 | 0.00022 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Phaeodactylum tricornutum | 2850 | S | 137 | 8 | 145 | 0.00026 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Thalassiosira pseudonana | 35128 | S | 101 | 10 | 111 | 0.00020 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Homo sapiens | 9606 | S | 130 | 41 | 171 | 0.00030 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Malassezia restricta | 76775 | S | 27 | 7 | 34 | 0.00006 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
| ERR6913223 | Severe acute respiratory syndrome-related coronavirus | 694009 | S | 105 | 0 | 105 | 0.00019 | P381_cDNA_L001 | P381 | RNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-cDNA-sequenced | 22.18 | 21573718 | 1173894 | 158775396 |
slice_head(abun_long)
| run_accession | taxon_name | taxonomy_id | taxonomy_lvl | kraken_assigned_reads | added_reads | new_est_reads | fraction_total_reads | host_subject_id | patient_code | nuc | host_body_site | host_disease_status | miscellaneous_parameter | Ct | total_reads | read_count | base_count |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| <chr> | <chr> | <int> | <chr> | <int> | <int> | <int> | <dbl> | <chr> | <chr> | <chr> | <chr> | <chr> | <chr> | <dbl> | <int> | <int> | <int> |
| ERR6913112 | Streptococcus oralis | 1303 | S | 315 | 139 | 454 | 0.04101 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 |
abun_long %>% select(kraken_assigned_reads,added_reads,new_est_reads,fraction_total_reads)
| kraken_assigned_reads | added_reads | new_est_reads | fraction_total_reads |
|---|---|---|---|
| <int> | <int> | <int> | <dbl> |
| 315 | 139 | 454 | 0.04101 |
| 64 | 14 | 78 | 0.00705 |
| 50 | 10 | 60 | 0.00542 |
| 14 | 21 | 35 | 0.00316 |
| 11 | 1 | 12 | 0.00108 |
| 171 | 60 | 231 | 0.02087 |
| 135 | 24 | 159 | 0.01436 |
| 106 | 32 | 138 | 0.01246 |
| 69 | 10 | 79 | 0.00714 |
| 59 | 9 | 68 | 0.00614 |
| 57 | 2 | 59 | 0.00533 |
| 25 | 17 | 42 | 0.00379 |
| 24 | 1 | 25 | 0.00226 |
| 21 | 2 | 23 | 0.00208 |
| 17 | 5 | 22 | 0.00199 |
| 11 | 3 | 14 | 0.00126 |
| 514 | 4 | 518 | 0.04679 |
| 21 | 0 | 21 | 0.00190 |
| 103 | 10 | 113 | 0.01021 |
| 48 | 9 | 57 | 0.00515 |
| 11 | 3 | 14 | 0.00126 |
| 24 | 9 | 33 | 0.00298 |
| 13 | 0 | 13 | 0.00117 |
| 47 | 1 | 48 | 0.00434 |
| 33 | 13 | 46 | 0.00415 |
| 240 | 5 | 245 | 0.02213 |
| 112 | 2 | 114 | 0.01030 |
| 112 | 33 | 145 | 0.01310 |
| 78 | 10 | 88 | 0.00795 |
| 65 | 15 | 80 | 0.00723 |
| ⋮ | ⋮ | ⋮ | ⋮ |
| 17 | 96 | 113 | 0.00020 |
| 60 | 96 | 156 | 0.00028 |
| 25 | 98 | 123 | 0.00022 |
| 18 | 24 | 42 | 0.00007 |
| 16 | 8 | 24 | 0.00004 |
| 11 | 4 | 15 | 0.00003 |
| 79 | 86 | 165 | 0.00029 |
| 13 | 27 | 40 | 0.00007 |
| 30 | 11 | 41 | 0.00007 |
| 10 | 10 | 20 | 0.00004 |
| 33 | 16 | 49 | 0.00009 |
| 78 | 28 | 106 | 0.00019 |
| 26 | 17 | 43 | 0.00008 |
| 11 | 35 | 46 | 0.00008 |
| 11 | 149 | 160 | 0.00028 |
| 25 | 54 | 79 | 0.00014 |
| 16 | 9 | 25 | 0.00004 |
| 26 | 44 | 70 | 0.00012 |
| 23 | 16 | 39 | 0.00007 |
| 17 | 26 | 43 | 0.00008 |
| 29 | 14 | 43 | 0.00008 |
| 35 | 20 | 55 | 0.00010 |
| 32 | 52 | 84 | 0.00015 |
| 24 | 126 | 150 | 0.00026 |
| 104 | 18 | 122 | 0.00022 |
| 137 | 8 | 145 | 0.00026 |
| 101 | 10 | 111 | 0.00020 |
| 130 | 41 | 171 | 0.00030 |
| 27 | 7 | 34 | 0.00006 |
| 105 | 0 | 105 | 0.00019 |
dim(abun_long)
summary(abun_long$fraction_total_reads)
Min. 1st Qu. Median Mean 3rd Qu. Max. 0.000000 0.000010 0.000030 0.001365 0.000160 1.000000
abun_long %>%
select(run_accession, taxon_name, fraction_total_reads, new_est_reads, read_count, total_reads)
| run_accession | taxon_name | fraction_total_reads | new_est_reads | read_count | total_reads |
|---|---|---|---|---|---|
| <chr> | <chr> | <dbl> | <int> | <int> | <int> |
| ERR6913112 | Streptococcus oralis | 0.04101 | 454 | 63444 | 25543682 |
| ERR6913112 | Streptococcus sp. LPB0220 | 0.00705 | 78 | 63444 | 25543682 |
| ERR6913112 | Streptococcus sp. HSISM1 | 0.00542 | 60 | 63444 | 25543682 |
| ERR6913112 | Streptococcus sp. oral taxon 064 | 0.00316 | 35 | 63444 | 25543682 |
| ERR6913112 | Streptococcus sp. oral taxon 061 | 0.00108 | 12 | 63444 | 25543682 |
| ERR6913112 | Streptococcus salivarius | 0.02087 | 231 | 63444 | 25543682 |
| ERR6913112 | Streptococcus mitis | 0.01436 | 159 | 63444 | 25543682 |
| ERR6913112 | Streptococcus intermedius | 0.01246 | 138 | 63444 | 25543682 |
| ERR6913112 | Streptococcus vestibularis | 0.00714 | 79 | 63444 | 25543682 |
| ERR6913112 | Streptococcus parasanguinis | 0.00614 | 68 | 63444 | 25543682 |
| ERR6913112 | Streptococcus gordonii | 0.00533 | 59 | 63444 | 25543682 |
| ERR6913112 | Streptococcus pneumoniae | 0.00379 | 42 | 63444 | 25543682 |
| ERR6913112 | Streptococcus mutans | 0.00226 | 25 | 63444 | 25543682 |
| ERR6913112 | Streptococcus infantis | 0.00208 | 23 | 63444 | 25543682 |
| ERR6913112 | Streptococcus gwangjuense | 0.00199 | 22 | 63444 | 25543682 |
| ERR6913112 | Streptococcus pseudopneumoniae | 0.00126 | 14 | 63444 | 25543682 |
| ERR6913112 | Dolosigranulum pigrum | 0.04679 | 518 | 63444 | 25543682 |
| ERR6913112 | Granulicatella adiacens | 0.00190 | 21 | 63444 | 25543682 |
| ERR6913112 | Ligilactobacillus salivarius | 0.01021 | 113 | 63444 | 25543682 |
| ERR6913112 | Limosilactobacillus portuensis | 0.00515 | 57 | 63444 | 25543682 |
| ERR6913112 | Limosilactobacillus fermentum | 0.00126 | 14 | 63444 | 25543682 |
| ERR6913112 | Lactobacillus gasseri | 0.00298 | 33 | 63444 | 25543682 |
| ERR6913112 | Lactobacillus crispatus | 0.00117 | 13 | 63444 | 25543682 |
| ERR6913112 | Enterococcus cecorum | 0.00434 | 48 | 63444 | 25543682 |
| ERR6913112 | Staphylococcus epidermidis | 0.00415 | 46 | 63444 | 25543682 |
| ERR6913112 | Veillonella parvula | 0.02213 | 245 | 63444 | 25543682 |
| ERR6913112 | Veillonella atypica | 0.01030 | 114 | 63444 | 25543682 |
| ERR6913112 | Veillonella nakazawae | 0.01310 | 145 | 63444 | 25543682 |
| ERR6913112 | Veillonella dispar | 0.00795 | 88 | 63444 | 25543682 |
| ERR6913112 | Veillonella sp. S12025-13 | 0.00723 | 80 | 63444 | 25543682 |
| ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ |
| ERR6913223 | Pseudomonas fluorescens | 0.00020 | 113 | 1173894 | 21573718 |
| ERR6913223 | Haemophilus parainfluenzae | 0.00028 | 156 | 1173894 | 21573718 |
| ERR6913223 | Xanthomonas campestris | 0.00022 | 123 | 1173894 | 21573718 |
| ERR6913223 | Stenotrophomonas maltophilia | 0.00007 | 42 | 1173894 | 21573718 |
| ERR6913223 | Cardiobacterium hominis | 0.00004 | 24 | 1173894 | 21573718 |
| ERR6913223 | Cardiobacterium sp. Marseille-Q4385 | 0.00003 | 15 | 1173894 | 21573718 |
| ERR6913223 | Lautropia mirabilis | 0.00029 | 165 | 1173894 | 21573718 |
| ERR6913223 | Achromobacter deleyi | 0.00007 | 40 | 1173894 | 21573718 |
| ERR6913223 | Dechloromonas sp. A34 | 0.00007 | 41 | 1173894 | 21573718 |
| ERR6913223 | Dechloromonas sp. TW-R-39-2 | 0.00004 | 20 | 1173894 | 21573718 |
| ERR6913223 | Dechloromonas denitrificans | 0.00009 | 49 | 1173894 | 21573718 |
| ERR6913223 | Ferribacterium limneticum | 0.00019 | 106 | 1173894 | 21573718 |
| ERR6913223 | Quatrionicoccus australiensis | 0.00008 | 43 | 1173894 | 21573718 |
| ERR6913223 | Azospira oryzae | 0.00008 | 46 | 1173894 | 21573718 |
| ERR6913223 | Kingella oralis | 0.00028 | 160 | 1173894 | 21573718 |
| ERR6913223 | Mesorhizobium terrae | 0.00014 | 79 | 1173894 | 21573718 |
| ERR6913223 | Methylobacterium sp. FF17 | 0.00004 | 25 | 1173894 | 21573718 |
| ERR6913223 | Novosphingobium sp. EMRT-2 | 0.00012 | 70 | 1173894 | 21573718 |
| ERR6913223 | Prevotella sp. oral taxon 475 | 0.00007 | 39 | 1173894 | 21573718 |
| ERR6913223 | Prevotella sp. oral taxon 299 | 0.00008 | 43 | 1173894 | 21573718 |
| ERR6913223 | Porphyromonas sp. oral taxon 275 | 0.00008 | 43 | 1173894 | 21573718 |
| ERR6913223 | Capnocytophaga gingivalis | 0.00010 | 55 | 1173894 | 21573718 |
| ERR6913223 | Capnocytophaga sputigena | 0.00015 | 84 | 1173894 | 21573718 |
| ERR6913223 | Fusobacterium nucleatum | 0.00026 | 150 | 1173894 | 21573718 |
| ERR6913223 | Leptotrichia sp. oral taxon 212 | 0.00022 | 122 | 1173894 | 21573718 |
| ERR6913223 | Phaeodactylum tricornutum | 0.00026 | 145 | 1173894 | 21573718 |
| ERR6913223 | Thalassiosira pseudonana | 0.00020 | 111 | 1173894 | 21573718 |
| ERR6913223 | Homo sapiens | 0.00030 | 171 | 1173894 | 21573718 |
| ERR6913223 | Malassezia restricta | 0.00006 | 34 | 1173894 | 21573718 |
| ERR6913223 | Severe acute respiratory syndrome-related coronavirus | 0.00019 | 105 | 1173894 | 21573718 |
abun_long %>%
select(run_accession, taxon_name, fraction_total_reads, new_est_reads, read_count, total_reads) %>%
filter(fraction_total_reads>0.1)
| run_accession | taxon_name | fraction_total_reads | new_est_reads | read_count | total_reads |
|---|---|---|---|---|---|
| <chr> | <chr> | <dbl> | <int> | <int> | <int> |
| ERR6913112 | Moraxella nonliquefaciens | 0.30232 | 3347 | 63444 | 25543682 |
| ERR6913113 | Vibrio kanaloae | 0.17019 | 1803 | 223844 | 21821962 |
| ERR6913320 | Prevotella melaninogenica | 0.24837 | 129907 | 1873994 | 22695514 |
| ERR6913209 | Corynebacterium segmentosum | 0.14747 | 470 | 28014 | 28082388 |
| ERR6913209 | Corynebacterium accolens | 0.12112 | 386 | 28014 | 28082388 |
| ERR6913209 | Acinetobacter junii | 0.18826 | 600 | 28014 | 28082388 |
| ERR6913122 | Prevotella jejuni | 0.16345 | 28510 | 745326 | 19148784 |
| ERR6913208 | Moraxella nonliquefaciens | 0.43645 | 19969 | 109226 | 17354398 |
| ERR6913208 | Moraxella bovoculi | 0.14709 | 6730 | 109226 | 17354398 |
| ERR6913218 | Prevotella jejuni | 0.15228 | 13646 | 286382 | 21843848 |
| ERR6913349 | Prevotella melaninogenica | 0.30589 | 460396 | 3193196 | 45144918 |
| ERR6913179 | Prevotella melaninogenica | 0.17401 | 115656 | 1769196 | 17377298 |
| ERR6913180 | Prevotella melaninogenica | 0.15419 | 105412 | 2234368 | 22081900 |
| ERR6913181 | Streptococcus salivarius | 0.47683 | 461431 | 2252564 | 19977940 |
| ERR6913181 | Veillonella atypica | 0.15035 | 145490 | 2252564 | 19977940 |
| ERR6913276 | Cutibacterium acnes | 0.42643 | 387713 | 3177948 | 17780890 |
| ERR6913278 | Veillonella parvula | 0.10595 | 134990 | 2714728 | 20047904 |
| ERR6913278 | Neisseria mucosa | 0.13850 | 176462 | 2714728 | 20047904 |
| ERR6913101 | Klebsiella pneumoniae | 0.33502 | 40475 | 658268 | 20246544 |
| ERR6913197 | Klebsiella pneumoniae | 0.32262 | 71821 | 758080 | 27027782 |
| ERR6913275 | Streptococcus mitis | 0.12788 | 34155 | 606162 | 20429462 |
| ERR6913275 | Streptococcus pneumoniae | 0.34980 | 93424 | 606162 | 20429462 |
| ERR6913277 | Streptococcus salivarius | 0.27982 | 344828 | 2870764 | 25512276 |
| ERR6913277 | Veillonella atypica | 0.12616 | 155472 | 2870764 | 25512276 |
| ERR6913191 | Prevotella intermedia | 0.29980 | 27960 | 283316 | 19546192 |
| ERR6913193 | Streptococcus salivarius | 0.11692 | 39960 | 812494 | 21176470 |
| ERR6913193 | Rothia mucilaginosa | 0.10168 | 34753 | 812494 | 21176470 |
| ERR6913236 | Prevotella veroralis | 0.10667 | 152080 | 3303920 | 15718784 |
| ERR6913291 | Veillonella atypica | 0.14908 | 179292 | 2739370 | 26470190 |
| ERR6913291 | Veillonella parvula | 0.10593 | 127399 | 2739370 | 26470190 |
| ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ |
| ERR6913266 | Streptococcus sanguinis | 0.10005 | 189 | 9030 | 22310726 |
| ERR6913266 | Veillonella parvula | 0.12546 | 237 | 9030 | 22310726 |
| ERR6913266 | Cutibacterium acnes | 0.16040 | 303 | 9030 | 22310726 |
| ERR6913109 | Cutibacterium acnes | 0.12969 | 1050 | 59176 | 24507262 |
| ERR6913164 | Vibrio kanaloae | 0.22370 | 1140 | 231186 | 21971474 |
| ERR6913164 | Pseudoalteromonas prydzensis | 0.13108 | 668 | 231186 | 21971474 |
| ERR6913172 | Vibrio kanaloae | 0.18087 | 9900 | 1047306 | 22377066 |
| ERR6913260 | Cutibacterium acnes | 0.20569 | 340 | 27568 | 20149704 |
| ERR6913260 | Pasteurella multocida | 0.10829 | 179 | 27568 | 20149704 |
| ERR6913260 | Phaeodactylum tricornutum | 0.10284 | 170 | 27568 | 20149704 |
| ERR6913129 | Streptococcus salivarius | 0.11233 | 20655 | 471008 | 19556696 |
| ERR6913129 | Porphyromonas endodontalis | 0.11378 | 20923 | 471008 | 19556696 |
| ERR6913130 | Prevotella jejuni | 0.21377 | 51425 | 649836 | 21999026 |
| ERR6913194 | Streptococcus salivarius | 0.10752 | 56663 | 1386316 | 18826866 |
| ERR6913196 | Prevotella melaninogenica | 0.25634 | 207296 | 2236474 | 22682382 |
| ERR6913196 | Veillonella atypica | 0.10632 | 85977 | 2236474 | 22682382 |
| ERR6913225 | Streptococcus salivarius | 0.11755 | 136996 | 2727870 | 26601948 |
| ERR6913226 | Streptococcus agalactiae | 0.11158 | 134816 | 2732518 | 18028410 |
| ERR6913292 | Prevotella melaninogenica | 0.25416 | 318340 | 2702312 | 21276022 |
| ERR6913292 | Veillonella atypica | 0.10924 | 136830 | 2702312 | 21276022 |
| ERR6913300 | Veillonella atypica | 0.17056 | 75246 | 1700124 | 20679390 |
| ERR6913300 | Prevotella melaninogenica | 0.12738 | 56198 | 1700124 | 20679390 |
| ERR6913301 | Prevotella jejuni | 0.16039 | 38567 | 907928 | 28012624 |
| ERR6913303 | Staphylococcus aureus | 0.62618 | 597928 | 2139748 | 20103510 |
| ERR6913332 | Staphylococcus aureus | 0.61502 | 684696 | 2489352 | 24091268 |
| ERR6913127 | Dolosigranulum pigrum | 0.48795 | 2652 | 30170 | 19048514 |
| ERR6913127 | Corynebacterium pseudodiphtheriticum | 0.30175 | 1640 | 30170 | 19048514 |
| ERR6913223 | Corynebacterium pseudodiphtheriticum | 0.30164 | 170981 | 1173894 | 21573718 |
| ERR6913223 | Corynebacterium glutamicum | 0.11430 | 64790 | 1173894 | 21573718 |
| ERR6913223 | Dolosigranulum pigrum | 0.46865 | 265649 | 1173894 | 21573718 |
abun_long %>%
select(run_accession, taxon_name, fraction_total_reads, new_est_reads, read_count, total_reads) %>%
filter(fraction_total_reads>0.1) %>%
arrange(desc(fraction_total_reads))
| run_accession | taxon_name | fraction_total_reads | new_est_reads | read_count | total_reads |
|---|---|---|---|---|---|
| <chr> | <chr> | <dbl> | <int> | <int> | <int> |
| ERR6913115 | Cutibacterium acnes | 1.00000 | 79 | 33254 | 18306476 |
| ERR6913154 | Haemophilus influenzae | 0.98190 | 15187 | 39244 | 18749066 |
| ERR6913269 | Influenza A virus | 0.97180 | 11614 | 25426 | 23544470 |
| ERR6913264 | Haemophilus influenzae | 0.92120 | 4618 | 21382 | 18079420 |
| ERR6913250 | Haemophilus influenzae | 0.88349 | 73565 | 169548 | 18898684 |
| ERR6913252 | Cutibacterium acnes | 0.86638 | 6542 | 19934 | 22690768 |
| ERR6913216 | Severe acute respiratory syndrome-related coronavirus | 0.77822 | 7797 | 39552 | 17198782 |
| ERR6913199 | Severe acute respiratory syndrome-related coronavirus | 0.75690 | 439 | 62396 | 20758064 |
| ERR6913221 | Severe acute respiratory syndrome-related coronavirus | 0.73823 | 4360 | 23570 | 19171612 |
| ERR6913314 | Klebsiella pneumoniae | 0.72546 | 756611 | 2148206 | 21206122 |
| ERR6913173 | Cutibacterium acnes | 0.71600 | 3111 | 27156 | 21165410 |
| ERR6913255 | Cutibacterium acnes | 0.65390 | 495 | 2708 | 21873400 |
| ERR6913303 | Staphylococcus aureus | 0.62618 | 597928 | 2139748 | 20103510 |
| ERR6913332 | Staphylococcus aureus | 0.61502 | 684696 | 2489352 | 24091268 |
| ERR6913117 | Cutibacterium acnes | 0.61149 | 362 | 397186 | 24205196 |
| ERR6913111 | Cutibacterium acnes | 0.61069 | 160 | 33240 | 27646936 |
| ERR6913211 | Cutibacterium acnes | 0.59885 | 312 | 39562 | 17691576 |
| ERR6913212 | Cutibacterium acnes | 0.57619 | 363 | 6948 | 20644176 |
| ERR6913219 | Corynebacterium propinquum | 0.56391 | 153136 | 615136 | 18437710 |
| ERR6913168 | Haemophilus influenzae | 0.53107 | 2743 | 142662 | 20396446 |
| ERR6913261 | Corynebacterium tuberculostearicum | 0.51247 | 370 | 8410 | 24026306 |
| ERR6913207 | Cutibacterium acnes | 0.50299 | 84 | 9240 | 25216066 |
| ERR6913127 | Dolosigranulum pigrum | 0.48795 | 2652 | 30170 | 19048514 |
| ERR6913181 | Streptococcus salivarius | 0.47683 | 461431 | 2252564 | 19977940 |
| ERR6913104 | Stenotrophomonas maltophilia | 0.47353 | 79533 | 610606 | 22910206 |
| ERR6913223 | Dolosigranulum pigrum | 0.46865 | 265649 | 1173894 | 21573718 |
| ERR6913322 | Klebsiella pneumoniae | 0.45093 | 534153 | 2441696 | 11522192 |
| ERR6913103 | Cutibacterium acnes | 0.44541 | 359 | 385740 | 21364260 |
| ERR6913262 | Pseudolabrys sp. FHR47 | 0.44188 | 5368 | 30798 | 20341522 |
| ERR6913208 | Moraxella nonliquefaciens | 0.43645 | 19969 | 109226 | 17354398 |
| ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ |
| ERR6913204 | Moraxella osloensis | 0.10701 | 1509 | 47600 | 27571556 |
| ERR6913298 | Neisseria mucosa | 0.10699 | 4528 | 364136 | 19913788 |
| ERR6913210 | Cutibacterium acnes | 0.10698 | 1590 | 107788 | 21965834 |
| ERR6913271 | Moraxella nonliquefaciens | 0.10673 | 50585 | 1309086 | 23805264 |
| ERR6913236 | Prevotella veroralis | 0.10667 | 152080 | 3303920 | 15718784 |
| ERR6913196 | Veillonella atypica | 0.10632 | 85977 | 2236474 | 22682382 |
| ERR6913278 | Veillonella parvula | 0.10595 | 134990 | 2714728 | 20047904 |
| ERR6913291 | Veillonella parvula | 0.10593 | 127399 | 2739370 | 26470190 |
| ERR6913343 | Neisseria meningitidis | 0.10547 | 180856 | 3478632 | 41696524 |
| ERR6913103 | Corynebacterium kefirresidentii | 0.10546 | 85 | 385740 | 21364260 |
| ERR6913265 | Mycoplasmoides pneumoniae | 0.10545 | 180 | 34894 | 15157352 |
| ERR6913345 | Streptococcus agalactiae | 0.10536 | 116804 | 2750394 | 21714858 |
| ERR6913342 | Streptococcus salivarius | 0.10533 | 193304 | 3754758 | 17613434 |
| ERR6913271 | Prevotella melaninogenica | 0.10480 | 49670 | 1309086 | 23805264 |
| ERR6913106 | Lacticaseibacillus paracasei | 0.10349 | 37796 | 1271618 | 23398900 |
| ERR6913136 | Prevotella veroralis | 0.10343 | 89995 | 2239760 | 20026148 |
| ERR6913312 | Rothia mucilaginosa | 0.10334 | 20096 | 1001132 | 18705528 |
| ERR6913280 | Veillonella parvula | 0.10314 | 148136 | 3018286 | 17282568 |
| ERR6913274 | Babesia bigemina | 0.10307 | 494 | 47250 | 16381626 |
| ERR6913125 | Shewanella algae | 0.10297 | 142 | 151202 | 16206168 |
| ERR6913260 | Phaeodactylum tricornutum | 0.10284 | 170 | 27568 | 20149704 |
| ERR6913251 | Burkholderia multivorans | 0.10269 | 103 | 9458 | 25147866 |
| ERR6913243 | Streptococcus agalactiae | 0.10265 | 130716 | 2851368 | 17773492 |
| ERR6913114 | Vibrio plantisponsor | 0.10182 | 888 | 299664 | 17624856 |
| ERR6913280 | Leptotrichia wadei | 0.10179 | 146196 | 3018286 | 17282568 |
| ERR6913345 | Veillonella parvula | 0.10169 | 112729 | 2750394 | 21714858 |
| ERR6913193 | Rothia mucilaginosa | 0.10168 | 34753 | 812494 | 21176470 |
| ERR6913323 | Streptococcus australis | 0.10100 | 83717 | 3066570 | 19424544 |
| ERR6913265 | Homo sapiens | 0.10076 | 172 | 34894 | 15157352 |
| ERR6913266 | Streptococcus sanguinis | 0.10005 | 189 | 9030 | 22310726 |
abun_long %>%
select(run_accession, taxon_name, fraction_total_reads, new_est_reads, read_count, total_reads) %>%
filter(fraction_total_reads>0.1) %>%
arrange(desc(fraction_total_reads)) %>%
slice_head(n=10)
| run_accession | taxon_name | fraction_total_reads | new_est_reads | read_count | total_reads |
|---|---|---|---|---|---|
| <chr> | <chr> | <dbl> | <int> | <int> | <int> |
| ERR6913115 | Cutibacterium acnes | 1.00000 | 79 | 33254 | 18306476 |
| ERR6913154 | Haemophilus influenzae | 0.98190 | 15187 | 39244 | 18749066 |
| ERR6913269 | Influenza A virus | 0.97180 | 11614 | 25426 | 23544470 |
| ERR6913264 | Haemophilus influenzae | 0.92120 | 4618 | 21382 | 18079420 |
| ERR6913250 | Haemophilus influenzae | 0.88349 | 73565 | 169548 | 18898684 |
| ERR6913252 | Cutibacterium acnes | 0.86638 | 6542 | 19934 | 22690768 |
| ERR6913216 | Severe acute respiratory syndrome-related coronavirus | 0.77822 | 7797 | 39552 | 17198782 |
| ERR6913199 | Severe acute respiratory syndrome-related coronavirus | 0.75690 | 439 | 62396 | 20758064 |
| ERR6913221 | Severe acute respiratory syndrome-related coronavirus | 0.73823 | 4360 | 23570 | 19171612 |
| ERR6913314 | Klebsiella pneumoniae | 0.72546 | 756611 | 2148206 | 21206122 |
abun_long <- abun_long %>%
mutate(fraction_nonhuman_reads=new_est_reads/read_count,
fraction_human_nonhuman_reads=new_est_reads/total_reads)
abun_long %>%
slice_head(n=10)
| run_accession | taxon_name | taxonomy_id | taxonomy_lvl | kraken_assigned_reads | added_reads | new_est_reads | fraction_total_reads | host_subject_id | patient_code | nuc | host_body_site | host_disease_status | miscellaneous_parameter | Ct | total_reads | read_count | base_count | fraction_nonhuman_reads | fraction_human_nonhuman_reads |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| <chr> | <chr> | <int> | <chr> | <int> | <int> | <int> | <dbl> | <chr> | <chr> | <chr> | <chr> | <chr> | <chr> | <dbl> | <int> | <int> | <int> | <dbl> | <dbl> |
| ERR6913112 | Streptococcus oralis | 1303 | S | 315 | 139 | 454 | 0.04101 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 | 0.0071559170 | 1.777348e-05 |
| ERR6913112 | Streptococcus sp. LPB0220 | 2610896 | S | 64 | 14 | 78 | 0.00705 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 | 0.0012294307 | 3.053593e-06 |
| ERR6913112 | Streptococcus sp. HSISM1 | 1316408 | S | 50 | 10 | 60 | 0.00542 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 | 0.0009457159 | 2.348917e-06 |
| ERR6913112 | Streptococcus sp. oral taxon 064 | 712624 | S | 14 | 21 | 35 | 0.00316 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 | 0.0005516676 | 1.370202e-06 |
| ERR6913112 | Streptococcus sp. oral taxon 061 | 712623 | S | 11 | 1 | 12 | 0.00108 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 | 0.0001891432 | 4.697835e-07 |
| ERR6913112 | Streptococcus salivarius | 1304 | S | 171 | 60 | 231 | 0.02087 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 | 0.0036410062 | 9.043332e-06 |
| ERR6913112 | Streptococcus mitis | 28037 | S | 135 | 24 | 159 | 0.01436 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 | 0.0025061472 | 6.224631e-06 |
| ERR6913112 | Streptococcus intermedius | 1338 | S | 106 | 32 | 138 | 0.01246 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 | 0.0021751466 | 5.402510e-06 |
| ERR6913112 | Streptococcus vestibularis | 1343 | S | 69 | 10 | 79 | 0.00714 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 | 0.0012451926 | 3.092741e-06 |
| ERR6913112 | Streptococcus parasanguinis | 1318 | S | 59 | 9 | 68 | 0.00614 | P259_DNA_S4_L001 | P259 | DNA | Nasopharyngeal | SARS-CoV-2 positive | Symptomatic-DNA-sequenced | 19.95 | 25543682 | 63444 | 8094624 | 0.0010718114 | 2.662106e-06 |
abun_long %>% select(run_accession,fraction_total_reads) %>% group_by(run_accession) %>% summarise(sum(fraction_total_reads))
| run_accession | sum(fraction_total_reads) |
|---|---|
| <chr> | <dbl> |
| ERR6913101 | 0.99698 |
| ERR6913102 | 0.99527 |
| ERR6913103 | 0.99008 |
| ERR6913104 | 0.99840 |
| ERR6913106 | 0.99967 |
| ERR6913107 | 0.99770 |
| ERR6913108 | 0.99640 |
| ERR6913109 | 0.99193 |
| ERR6913111 | 0.98855 |
| ERR6913112 | 0.99706 |
| ERR6913113 | 0.99214 |
| ERR6913114 | 0.99702 |
| ERR6913115 | 1.00000 |
| ERR6913116 | 0.99427 |
| ERR6913117 | 0.99325 |
| ERR6913118 | 0.99824 |
| ERR6913120 | 0.99409 |
| ERR6913121 | 0.99418 |
| ERR6913122 | 0.99866 |
| ERR6913123 | 0.99718 |
| ERR6913124 | 0.99848 |
| ERR6913125 | 0.99493 |
| ERR6913126 | 0.99461 |
| ERR6913127 | 0.99907 |
| ERR6913128 | 0.99973 |
| ERR6913129 | 1.00280 |
| ERR6913130 | 0.99255 |
| ERR6913131 | 1.00045 |
| ERR6913132 | 0.99916 |
| ERR6913133 | 0.99783 |
| ⋮ | ⋮ |
| ERR6913307 | 0.99956 |
| ERR6913308 | 0.99985 |
| ERR6913312 | 0.99855 |
| ERR6913313 | 0.99983 |
| ERR6913314 | 0.99986 |
| ERR6913315 | 0.99843 |
| ERR6913316 | 0.99748 |
| ERR6913320 | 0.99839 |
| ERR6913322 | 0.99989 |
| ERR6913323 | 0.99959 |
| ERR6913324 | 0.99565 |
| ERR6913325 | 0.99925 |
| ERR6913326 | 0.99967 |
| ERR6913327 | 0.99944 |
| ERR6913328 | 0.99818 |
| ERR6913329 | 0.99841 |
| ERR6913330 | 0.99901 |
| ERR6913331 | 0.99833 |
| ERR6913332 | 0.99981 |
| ERR6913333 | 0.99990 |
| ERR6913334 | 0.99972 |
| ERR6913335 | 0.99959 |
| ERR6913336 | 0.99965 |
| ERR6913337 | 0.99989 |
| ERR6913341 | 1.00040 |
| ERR6913342 | 1.00012 |
| ERR6913343 | 0.99989 |
| ERR6913344 | 0.99969 |
| ERR6913345 | 0.99962 |
| ERR6913349 | 0.99994 |
SARS_CoV-2
taxon_name = Severe acute respiratory syndrome-related coronavirus
taxonomy_id = 694009
sars_abun <- abun_long %>% select(run_accession, taxon_name, taxonomy_id,fraction_total_reads,Ct,fraction_nonhuman_reads,host_disease_status) %>%
filter(taxonomy_id==694009) %>%
arrange(desc(fraction_nonhuman_reads))
slice_head(sars_abun,n=20)
| run_accession | taxon_name | taxonomy_id | fraction_total_reads | Ct | fraction_nonhuman_reads | host_disease_status |
|---|---|---|---|---|---|---|
| <chr> | <chr> | <int> | <dbl> | <dbl> | <dbl> | <chr> |
| ERR6913216 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.77822 | 17.99 | 0.1971328883 | SARS-CoV-2 positive |
| ERR6913221 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.73823 | 17.88 | 0.1849809079 | SARS-CoV-2 positive |
| ERR6913214 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.38784 | 17.81 | 0.0576540004 | SARS-CoV-2 positive |
| ERR6913210 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.41324 | 19.52 | 0.0569822244 | SARS-CoV-2 positive |
| ERR6913204 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.17501 | 18.42 | 0.0518487395 | SARS-CoV-2 positive |
| ERR6913203 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.21930 | 19.38 | 0.0412597045 | SARS-CoV-2 positive |
| ERR6913217 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.19576 | 17.56 | 0.0292371171 | SARS-CoV-2 positive |
| ERR6913215 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.22142 | 18.89 | 0.0278418723 | SARS-CoV-2 positive |
| ERR6913219 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.04292 | 17.93 | 0.0189486553 | SARS-CoV-2 positive |
| ERR6913197 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.04034 | 18.00 | 0.0118457155 | SARS-CoV-2 positive |
| ERR6913208 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.02116 | 19.95 | 0.0088623588 | SARS-CoV-2 positive |
| ERR6913220 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.01979 | 19.64 | 0.0085605285 | SARS-CoV-2 positive |
| ERR6913199 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.75690 | 18.81 | 0.0070357074 | SARS-CoV-2 positive |
| ERR6913218 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.01710 | 17.55 | 0.0053494982 | SARS-CoV-2 positive |
| ERR6913211 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.28791 | 19.63 | 0.0037915171 | SARS-CoV-2 positive |
| ERR6913200 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00751 | 18.02 | 0.0034187199 | SARS-CoV-2 positive |
| ERR6913212 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.03651 | 23.43 | 0.0033103051 | SARS-CoV-2 positive |
| ERR6913327 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00320 | 23.37 | 0.0013253006 | SARS-CoV-2 positive |
| ERR6913209 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00753 | 23.92 | 0.0008567145 | SARS-CoV-2 positive |
| ERR6913121 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00777 | 17.56 | 0.0006381674 | SARS-CoV-2 positive |
abun_long %>% select(run_accession, taxon_name, taxonomy_id,fraction_total_reads,Ct,fraction_nonhuman_reads,host_disease_status) %>%
filter(grepl("corona",taxon_name,fixed = TRUE)) %>%
arrange(desc(fraction_nonhuman_reads))
| run_accession | taxon_name | taxonomy_id | fraction_total_reads | Ct | fraction_nonhuman_reads | host_disease_status |
|---|---|---|---|---|---|---|
| <chr> | <chr> | <int> | <dbl> | <dbl> | <dbl> | <chr> |
| ERR6913216 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.77822 | 17.99 | 0.1971328883 | SARS-CoV-2 positive |
| ERR6913221 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.73823 | 17.88 | 0.1849809079 | SARS-CoV-2 positive |
| ERR6913214 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.38784 | 17.81 | 0.0576540004 | SARS-CoV-2 positive |
| ERR6913210 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.41324 | 19.52 | 0.0569822244 | SARS-CoV-2 positive |
| ERR6913204 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.17501 | 18.42 | 0.0518487395 | SARS-CoV-2 positive |
| ERR6913203 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.21930 | 19.38 | 0.0412597045 | SARS-CoV-2 positive |
| ERR6913217 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.19576 | 17.56 | 0.0292371171 | SARS-CoV-2 positive |
| ERR6913215 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.22142 | 18.89 | 0.0278418723 | SARS-CoV-2 positive |
| ERR6913219 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.04292 | 17.93 | 0.0189486553 | SARS-CoV-2 positive |
| ERR6913197 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.04034 | 18.00 | 0.0118457155 | SARS-CoV-2 positive |
| ERR6913208 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.02116 | 19.95 | 0.0088623588 | SARS-CoV-2 positive |
| ERR6913220 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.01979 | 19.64 | 0.0085605285 | SARS-CoV-2 positive |
| ERR6913199 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.75690 | 18.81 | 0.0070357074 | SARS-CoV-2 positive |
| ERR6913218 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.01710 | 17.55 | 0.0053494982 | SARS-CoV-2 positive |
| ERR6913252 | Human coronavirus HKU1 | 290028 | 0.01059 | 0.00 | 0.0040132437 | SARS-CoV-2 negative |
| ERR6913211 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.28791 | 19.63 | 0.0037915171 | SARS-CoV-2 positive |
| ERR6913200 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00751 | 18.02 | 0.0034187199 | SARS-CoV-2 positive |
| ERR6913212 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.03651 | 23.43 | 0.0033103051 | SARS-CoV-2 positive |
| ERR6913261 | Human coronavirus NL63 | 277944 | 0.02909 | 0.00 | 0.0024970273 | SARS-CoV-2 negative |
| ERR6913327 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00320 | 23.37 | 0.0013253006 | SARS-CoV-2 positive |
| ERR6913209 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00753 | 23.92 | 0.0008567145 | SARS-CoV-2 positive |
| ERR6913121 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00777 | 17.56 | 0.0006381674 | SARS-CoV-2 positive |
| ERR6913330 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00159 | 19.55 | 0.0005329715 | SARS-CoV-2 positive |
| ERR6913326 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00092 | 20.29 | 0.0003524103 | SARS-CoV-2 positive |
| ERR6913213 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.04115 | 21.34 | 0.0003137944 | SARS-CoV-2 positive |
| ERR6913275 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00063 | 27.65 | 0.0002771536 | SARS-CoV-2 negative |
| ERR6913329 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00102 | 24.73 | 0.0002373196 | SARS-CoV-2 positive |
| ERR6913322 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00044 | 17.53 | 0.0002117381 | SARS-CoV-2 positive |
| ERR6913101 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00106 | 18.00 | 0.0001944497 | SARS-CoV-2 positive |
| ERR6913268 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00140 | 0.00 | 0.0001807624 | SARS-CoV-2 negative |
| ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ |
| ERR6913328 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00069 | 25.72 | 9.325615e-05 | SARS-CoV-2 positive |
| ERR6913223 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00019 | 22.18 | 8.944590e-05 | SARS-CoV-2 positive |
| ERR6913334 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00013 | 0.00 | 5.814844e-05 | SARS-CoV-2 negative |
| ERR6913104 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00017 | 18.02 | 4.749380e-05 | SARS-CoV-2 positive |
| ERR6913312 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00020 | 0.00 | 3.895590e-05 | SARS-CoV-2 negative |
| ERR6913202 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00009 | 19.59 | 3.882656e-05 | SARS-CoV-2 positive |
| ERR6913332 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00008 | 19.51 | 3.615399e-05 | SARS-CoV-2 positive |
| ERR6913295 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00019 | 25.64 | 2.455337e-05 | SARS-CoV-2 positive |
| ERR6913324 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00019 | 25.64 | 2.455337e-05 | SARS-CoV-2 positive |
| ERR6913333 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00005 | 23.52 | 2.190989e-05 | SARS-CoV-2 positive |
| ERR6913242 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00007 | NA | 1.935648e-05 | SARS-CoV-2 positive |
| ERR6913345 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00002 | 0.00 | 9.453191e-06 | SARS-CoV-2 negative |
| ERR6913342 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00002 | 0.00 | 9.055177e-06 | SARS-CoV-2 negative |
| ERR6913276 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00003 | 21.94 | 8.181380e-06 | SARS-CoV-2 negative |
| ERR6913306 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00002 | 0.00 | 8.055400e-06 | SARS-CoV-2 negative |
| ERR6913222 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00002 | 17.28 | 7.086245e-06 | SARS-CoV-2 positive |
| ERR6913276 | Pseudomonas coronafaciens | 53409 | 0.00002 | 21.94 | 6.608038e-06 | SARS-CoV-2 negative |
| ERR6913323 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00002 | 22.39 | 6.521945e-06 | SARS-CoV-2 positive |
| ERR6913313 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00002 | 0.00 | 6.085766e-06 | SARS-CoV-2 negative |
| ERR6913325 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00002 | 24.14 | 5.481789e-06 | SARS-CoV-2 positive |
| ERR6913271 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00001 | NA | 4.583351e-06 | SARS-CoV-2 negative |
| ERR6913307 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00001 | 0.00 | 3.998637e-06 | SARS-CoV-2 negative |
| ERR6913343 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00001 | 0.00 | 3.162163e-06 | SARS-CoV-2 negative |
| ERR6913196 | Pseudomonas coronafaciens | 53409 | 0.00001 | 18.29 | 3.129927e-06 | SARS-CoV-2 negative |
| ERR6913228 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00001 | 25.21 | 2.175078e-06 | SARS-CoV-2 positive |
| ERR6913344 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00000 | 0.00 | 2.100279e-06 | SARS-CoV-2 negative |
| ERR6913194 | Pseudomonas coronafaciens | 53409 | 0.00000 | 27.00 | 1.442673e-06 | SARS-CoV-2 negative |
| ERR6913290 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00000 | 27.00 | 7.818156e-07 | SARS-CoV-2 negative |
| ERR6913292 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00000 | 18.29 | 7.401070e-07 | SARS-CoV-2 negative |
| ERR6913225 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00000 | 22.55 | 3.665864e-07 | SARS-CoV-2 positive |
library("ggplot2")
library("ggpubr")
ggscatter(sars_abun, x = "fraction_nonhuman_reads", y = "Ct",
add="reg.line", add.params = list(color = "#00bfc4"),
conf.int = FALSE,
cor.coef = TRUE,
cor.coeff.args = list(method = "spearman"),
#cor.method = "spearman",
ggtheme = theme_classic(),
#add = "reg.line", add.params = c(color = '#00bfc4'),
title = "Ct - fraction_nonhuman_reads", xlab = "fraction_nonhuman_reads", ylab = "Ct",
font.tickslab = c(size=15, color = "black"), font.main = 20,font.y = 15, font.x = 15)
`geom_smooth()` using formula 'y ~ x' Warning message: “Removed 3 rows containing non-finite values (stat_smooth).” Warning message: “Removed 3 rows containing non-finite values (stat_cor).” Warning message: “Removed 3 rows containing missing values (geom_point).”
colnames(abun_long)
Check if there are any SARS-CoV-2 negative patient express SARS-CoV-2
abun_long %>% select(run_accession, taxon_name, taxonomy_id,fraction_total_reads,Ct,fraction_nonhuman_reads,host_disease_status) %>%
filter(taxonomy_id==694009 & host_disease_status =="SARS-CoV-2 negative")
#arrange(desc(fraction_nonhuman_reads))
| run_accession | taxon_name | taxonomy_id | fraction_total_reads | Ct | fraction_nonhuman_reads | host_disease_status |
|---|---|---|---|---|---|---|
| <chr> | <chr> | <int> | <dbl> | <dbl> | <dbl> | <chr> |
| ERR6913276 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00003 | 21.94 | 8.181380e-06 | SARS-CoV-2 negative |
| ERR6913275 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00063 | 27.65 | 2.771536e-04 | SARS-CoV-2 negative |
| ERR6913271 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00001 | NA | 4.583351e-06 | SARS-CoV-2 negative |
| ERR6913305 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00046 | 0.00 | 1.590100e-04 | SARS-CoV-2 negative |
| ERR6913334 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00013 | 0.00 | 5.814844e-05 | SARS-CoV-2 negative |
| ERR6913306 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00002 | 0.00 | 8.055400e-06 | SARS-CoV-2 negative |
| ERR6913307 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00001 | 0.00 | 3.998637e-06 | SARS-CoV-2 negative |
| ERR6913345 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00002 | 0.00 | 9.453191e-06 | SARS-CoV-2 negative |
| ERR6913312 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00020 | 0.00 | 3.895590e-05 | SARS-CoV-2 negative |
| ERR6913315 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00053 | 0.00 | 1.124646e-04 | SARS-CoV-2 negative |
| ERR6913343 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00001 | 0.00 | 3.162163e-06 | SARS-CoV-2 negative |
| ERR6913344 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00000 | 0.00 | 2.100279e-06 | SARS-CoV-2 negative |
| ERR6913254 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00226 | 0.00 | 1.701702e-04 | SARS-CoV-2 negative |
| ERR6913313 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00002 | 0.00 | 6.085766e-06 | SARS-CoV-2 negative |
| ERR6913342 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00002 | 0.00 | 9.055177e-06 | SARS-CoV-2 negative |
| ERR6913267 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00242 | 0.00 | 1.415194e-04 | SARS-CoV-2 negative |
| ERR6913268 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00140 | 0.00 | 1.807624e-04 | SARS-CoV-2 negative |
| ERR6913290 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00000 | 27.00 | 7.818156e-07 | SARS-CoV-2 negative |
| ERR6913292 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00000 | 18.29 | 7.401070e-07 | SARS-CoV-2 negative |
Check is SARS-CoV-2 only ever seen in RNA samples (ie not in DNA samples)?
abun_long %>% select(run_accession, taxon_name, taxonomy_id,fraction_total_reads,Ct,fraction_nonhuman_reads,host_disease_status,nuc) %>%
filter(taxonomy_id==694009 & nuc=="RNA")
| run_accession | taxon_name | taxonomy_id | fraction_total_reads | Ct | fraction_nonhuman_reads | host_disease_status | nuc |
|---|---|---|---|---|---|---|---|
| <chr> | <chr> | <int> | <dbl> | <dbl> | <dbl> | <chr> | <chr> |
| ERR6913209 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00753 | 23.92 | 8.567145e-04 | SARS-CoV-2 positive | RNA |
| ERR6913208 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.02116 | 19.95 | 8.862359e-03 | SARS-CoV-2 positive | RNA |
| ERR6913218 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.01710 | 17.55 | 5.349498e-03 | SARS-CoV-2 positive | RNA |
| ERR6913276 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00003 | 21.94 | 8.181380e-06 | SARS-CoV-2 negative | RNA |
| ERR6913197 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.04034 | 18.00 | 1.184572e-02 | SARS-CoV-2 positive | RNA |
| ERR6913275 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00063 | 27.65 | 2.771536e-04 | SARS-CoV-2 negative | RNA |
| ERR6913222 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00002 | 17.28 | 7.086245e-06 | SARS-CoV-2 positive | RNA |
| ERR6913324 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00019 | 25.64 | 2.455337e-05 | SARS-CoV-2 positive | RNA |
| ERR6913327 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00320 | 23.37 | 1.325301e-03 | SARS-CoV-2 positive | RNA |
| ERR6913328 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00069 | 25.72 | 9.325615e-05 | SARS-CoV-2 positive | RNA |
| ERR6913271 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00001 | NA | 4.583351e-06 | SARS-CoV-2 negative | RNA |
| ERR6913326 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00092 | 20.29 | 3.524103e-04 | SARS-CoV-2 positive | RNA |
| ERR6913202 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00009 | 19.59 | 3.882656e-05 | SARS-CoV-2 positive | RNA |
| ERR6913199 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.75690 | 18.81 | 7.035707e-03 | SARS-CoV-2 positive | RNA |
| ERR6913211 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.28791 | 19.63 | 3.791517e-03 | SARS-CoV-2 positive | RNA |
| ERR6913213 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.04115 | 21.34 | 3.137944e-04 | SARS-CoV-2 positive | RNA |
| ERR6913204 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.17501 | 18.42 | 5.184874e-02 | SARS-CoV-2 positive | RNA |
| ERR6913212 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.03651 | 23.43 | 3.310305e-03 | SARS-CoV-2 positive | RNA |
| ERR6913214 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.38784 | 17.81 | 5.765400e-02 | SARS-CoV-2 positive | RNA |
| ERR6913334 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00013 | 0.00 | 5.814844e-05 | SARS-CoV-2 negative | RNA |
| ERR6913345 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00002 | 0.00 | 9.453191e-06 | SARS-CoV-2 negative | RNA |
| ERR6913343 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00001 | 0.00 | 3.162163e-06 | SARS-CoV-2 negative | RNA |
| ERR6913344 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00000 | 0.00 | 2.100279e-06 | SARS-CoV-2 negative | RNA |
| ERR6913254 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00226 | 0.00 | 1.701702e-04 | SARS-CoV-2 negative | RNA |
| ERR6913200 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00751 | 18.02 | 3.418720e-03 | SARS-CoV-2 positive | RNA |
| ERR6913230 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00032 | 23.01 | 1.213615e-04 | SARS-CoV-2 positive | RNA |
| ERR6913228 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00001 | 25.21 | 2.175078e-06 | SARS-CoV-2 positive | RNA |
| ERR6913219 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.04292 | 17.93 | 1.894866e-02 | SARS-CoV-2 positive | RNA |
| ERR6913210 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.41324 | 19.52 | 5.698222e-02 | SARS-CoV-2 positive | RNA |
| ERR6913220 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.01979 | 19.64 | 8.560529e-03 | SARS-CoV-2 positive | RNA |
| ERR6913217 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.19576 | 17.56 | 2.923712e-02 | SARS-CoV-2 positive | RNA |
| ERR6913325 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00002 | 24.14 | 5.481789e-06 | SARS-CoV-2 positive | RNA |
| ERR6913331 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00047 | 25.49 | 1.182014e-04 | SARS-CoV-2 positive | RNA |
| ERR6913333 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00005 | 23.52 | 2.190989e-05 | SARS-CoV-2 positive | RNA |
| ERR6913216 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.77822 | 17.99 | 1.971329e-01 | SARS-CoV-2 positive | RNA |
| ERR6913221 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.73823 | 17.88 | 1.849809e-01 | SARS-CoV-2 positive | RNA |
| ERR6913215 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.22142 | 18.89 | 2.784187e-02 | SARS-CoV-2 positive | RNA |
| ERR6913322 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00044 | 17.53 | 2.117381e-04 | SARS-CoV-2 positive | RNA |
| ERR6913342 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00002 | 0.00 | 9.055177e-06 | SARS-CoV-2 negative | RNA |
| ERR6913323 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00002 | 22.39 | 6.521945e-06 | SARS-CoV-2 positive | RNA |
| ERR6913267 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00242 | 0.00 | 1.415194e-04 | SARS-CoV-2 negative | RNA |
| ERR6913242 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00007 | NA | 1.935648e-05 | SARS-CoV-2 positive | RNA |
| ERR6913203 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.21930 | 19.38 | 4.125970e-02 | SARS-CoV-2 positive | RNA |
| ERR6913233 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00030 | 26.37 | 1.279669e-04 | SARS-CoV-2 positive | RNA |
| ERR6913268 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00140 | 0.00 | 1.807624e-04 | SARS-CoV-2 negative | RNA |
| ERR6913205 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00023 | 23.66 | 1.080517e-04 | SARS-CoV-2 positive | RNA |
| ERR6913225 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00000 | 22.55 | 3.665864e-07 | SARS-CoV-2 positive | RNA |
| ERR6913226 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00035 | NA | 1.566321e-04 | SARS-CoV-2 positive | RNA |
| ERR6913290 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00000 | 27.00 | 7.818156e-07 | SARS-CoV-2 negative | RNA |
| ERR6913292 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00000 | 18.29 | 7.401070e-07 | SARS-CoV-2 negative | RNA |
| ERR6913329 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00102 | 24.73 | 2.373196e-04 | SARS-CoV-2 positive | RNA |
| ERR6913330 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00159 | 19.55 | 5.329715e-04 | SARS-CoV-2 positive | RNA |
| ERR6913332 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00008 | 19.51 | 3.615399e-05 | SARS-CoV-2 positive | RNA |
| ERR6913223 | Severe acute respiratory syndrome-related coronavirus | 694009 | 0.00019 | 22.18 | 8.944590e-05 | SARS-CoV-2 positive | RNA |
10 most ubiquitous human pathogens found in the 125 patients
abun_long %>% select(run_accession, taxon_name, taxonomy_id,fraction_nonhuman_reads) %>%
group_by(taxon_name) %>%
summarise(MAX = max(fraction_nonhuman_reads)) %>%
arrange(desc(MAX)) %>% slice_head(n=10)
| taxon_name | MAX |
|---|---|
| <chr> | <dbl> |
| Influenza A virus | 0.4567765 |
| Haemophilus influenzae | 0.4338889 |
| Klebsiella pneumoniae | 0.3522060 |
| Cutibacterium acnes | 0.3281830 |
| Staphylococcus aureus | 0.2794385 |
| Corynebacterium propinquum | 0.2489466 |
| Dolosigranulum pigrum | 0.2262973 |
| Streptococcus salivarius | 0.2048470 |
| Severe acute respiratory syndrome-related coronavirus | 0.1971329 |
| Moraxella nonliquefaciens | 0.1828228 |
abun_wild <-
abun_long %>% select(run_accession, taxon_name, fraction_nonhuman_reads) %>%
pivot_wider(names_from = taxon_name, values_from = fraction_nonhuman_reads, values_fill = 0)
slice_head(abun_wild, n=5)
| run_accession | Streptococcus oralis | Streptococcus sp. LPB0220 | Streptococcus sp. HSISM1 | Streptococcus sp. oral taxon 064 | Streptococcus sp. oral taxon 061 | Streptococcus salivarius | Streptococcus mitis | Streptococcus intermedius | Streptococcus vestibularis | ⋯ | Staphylococcus sp. MZ9 | Staphylococcus sp. MZ8 | Chryseobacterium nepalense | Peeveelvirus CN125 | Biseptimavirus bv23MRA | Biseptimavirus IME136101 | Phietavirus pv3MRA | Staphylococcus sp. IVB6240 | Sutcliffiella cohnii | Aeromonas sp. Ne-1 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| <chr> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | ⋯ | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> |
| ERR6913112 | 0.007155917 | 0.001229431 | 0.0009457159 | 5.516676e-04 | 0.0001891432 | 0.003641006 | 0.002506147 | 2.175147e-03 | 0.0012451926 | ⋯ | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| ERR6913113 | 0.000000000 | 0.000000000 | 0.0000000000 | 0.000000e+00 | 0.0000000000 | 0.000000000 | 0.000000000 | 0.000000e+00 | 0.0000000000 | ⋯ | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| ERR6913320 | 0.003536297 | 0.007010695 | 0.0067006618 | 9.391706e-05 | 0.0019599849 | 0.003821250 | 0.007972277 | 1.787626e-04 | 0.0002022418 | ⋯ | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| ERR6913209 | 0.000000000 | 0.000000000 | 0.0000000000 | 0.000000e+00 | 0.0000000000 | 0.000000000 | 0.000000000 | 0.000000e+00 | 0.0000000000 | ⋯ | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| ERR6913122 | 0.001556366 | 0.002671314 | 0.0027679163 | 5.232610e-05 | 0.0015080649 | 0.015328863 | 0.002059501 | 7.513491e-05 | 0.0001194108 | ⋯ | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
abun_wild_taxon <-
abun_long %>% select(run_accession, taxon_name, fraction_nonhuman_reads) %>%
pivot_wider(names_from = run_accession, values_from = fraction_nonhuman_reads, values_fill = 0)
slice_head(abun_wild_taxon, n=5)
| taxon_name | ERR6913112 | ERR6913113 | ERR6913320 | ERR6913209 | ERR6913122 | ERR6913208 | ERR6913218 | ERR6913349 | ERR6913179 | ⋯ | ERR6913290 | ERR6913292 | ERR6913300 | ERR6913329 | ERR6913301 | ERR6913330 | ERR6913303 | ERR6913332 | ERR6913127 | ERR6913223 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| <chr> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | ⋯ | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> |
| Streptococcus oralis | 0.0071559170 | 0 | 3.536297e-03 | 0 | 0.0015563659 | 0 | 0.002035742 | 4.490799e-04 | 2.545224e-03 | ⋯ | 0.0019736935 | 0.0013114696 | 3.211530e-03 | 0.0006910871 | 2.970500e-03 | 1.011372e-03 | 3.771005e-03 | 0.0033699533 | 0 | 0.0001158537 |
| Streptococcus sp. LPB0220 | 0.0012294307 | 0 | 7.010695e-03 | 0 | 0.0026713143 | 0 | 0.004570818 | 6.347872e-04 | 3.729943e-03 | ⋯ | 0.0009987694 | 0.0017903188 | 6.110143e-03 | 0.0033781329 | 7.908116e-04 | 5.050799e-04 | 5.432415e-03 | 0.0045345134 | 0 | 0.0000000000 |
| Streptococcus sp. HSISM1 | 0.0009457159 | 0 | 6.700662e-03 | 0 | 0.0027679163 | 0 | 0.004249569 | 3.579486e-04 | 3.554157e-03 | ⋯ | 0.0008807153 | 0.0013018482 | 5.755463e-03 | 0.0026507134 | 7.324369e-04 | 3.553143e-04 | 4.838888e-03 | 0.0033096967 | 0 | 0.0000000000 |
| Streptococcus sp. oral taxon 064 | 0.0005516676 | 0 | 9.391706e-05 | 0 | 0.0000523261 | 0 | 0.000000000 | 1.785045e-05 | 5.200102e-05 | ⋯ | 0.0001203996 | 0.0001572727 | 8.293513e-05 | 0.0000000000 | 8.150426e-05 | 6.972892e-05 | 6.776499e-05 | 0.0001084620 | 0 | 0.0000000000 |
| Streptococcus sp. oral taxon 061 | 0.0001891432 | 0 | 1.959985e-03 | 0 | 0.0015080649 | 0 | 0.002084628 | 1.525118e-04 | 3.541722e-03 | ⋯ | 0.0010972782 | 0.0003500706 | 4.134993e-04 | 0.0001468753 | 7.390454e-04 | 2.067614e-04 | 1.416989e-03 | 0.0005925237 | 0 | 0.0000000000 |
options(repr.plot.width=20, repr.plot.height=15)
abun_long %>%
filter(str_detect(taxon_name,"corona")) %>%
arrange(nuc, fraction_total_reads) %>%
select(run_accession, taxon_name, new_est_reads,fraction_total_reads,Ct,fraction_nonhuman_reads,host_disease_status,miscellaneous_parameter,nuc,host_subject_id) %>%
ggplot(aes(host_subject_id, taxon_name, fill=log2(fraction_total_reads))) +
geom_raster(hjust = 0, vjust = 0)
library("heatmaply")
library(RColorBrewer)
Loading required package: plotly
Attaching package: ‘plotly’
The following object is masked from ‘package:ggplot2’:
last_plot
The following object is masked from ‘package:stats’:
filter
The following object is masked from ‘package:graphics’:
layout
Loading required package: viridis
Loading required package: viridisLite
======================
Welcome to heatmaply version 1.3.0
Type citation('heatmaply') for how to cite the package.
Type ?heatmaply for the main documentation.
The github page is: https://github.com/talgalili/heatmaply/
Please submit your suggestions and bug-reports at: https://github.com/talgalili/heatmaply/issues
You may ask questions at stackoverflow, use the r and heatmaply tags:
https://stackoverflow.com/questions/tagged/heatmaply
======================
abun_wild_taxon %>%
column_to_rownames(var="taxon_name") %>%
head(100) %>% mutate_if(is.numeric, ~ifelse(abs(.) == 0,0.0001,.)) %>%
mutate_if(is_double,log2)
| ERR6913112 | ERR6913113 | ERR6913320 | ERR6913209 | ERR6913122 | ERR6913208 | ERR6913218 | ERR6913349 | ERR6913179 | ERR6913180 | ⋯ | ERR6913290 | ERR6913292 | ERR6913300 | ERR6913329 | ERR6913301 | ERR6913330 | ERR6913303 | ERR6913332 | ERR6913127 | ERR6913223 | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | ⋯ | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | <dbl> | |
| Streptococcus oralis | -7.126648 | -13.28771 | -8.143545 | -13.28771 | -9.327603 | -13.287712 | -8.940229 | -11.120740 | -8.617992 | -7.488157 | ⋯ | -8.984886 | -9.574600 | -8.282523 | -10.498845 | -8.395079 | -9.949470 | -8.050835 | -8.213056 | -13.287712 | -13.075408 |
| Streptococcus sp. LPB0220 | -9.667794 | -13.28771 | -7.156227 | -13.28771 | -8.548235 | -13.287712 | -7.773332 | -10.621439 | -8.066631 | -11.495246 | ⋯ | -9.967561 | -9.125568 | -7.354578 | -8.209558 | -10.304378 | -10.951201 | -7.524190 | -7.784837 | -13.287712 | -13.287712 |
| Streptococcus sp. HSISM1 | -10.046306 | -13.28771 | -7.221481 | -13.28771 | -8.496984 | -13.287712 | -7.878468 | -11.447960 | -8.136277 | -11.361815 | ⋯ | -10.149037 | -9.585223 | -7.440852 | -8.559404 | -10.415008 | -11.458617 | -7.691109 | -8.239085 | -13.287712 | -13.287712 |
| Streptococcus sp. oral taxon 064 | -10.823913 | -13.28771 | -13.378253 | -13.28771 | -14.222110 | -13.287712 | -13.287712 | -15.773680 | -14.231100 | -13.264887 | ⋯ | -13.019882 | -12.634444 | -13.557657 | -13.287712 | -13.582765 | -13.807883 | -13.849100 | -13.170523 | -13.287712 | -13.287712 |
| Streptococcus sp. oral taxon 061 | -12.368234 | -13.28771 | -8.994942 | -13.28771 | -9.373086 | -13.287712 | -8.905994 | -12.678792 | -8.141333 | -7.095315 | ⋯ | -9.831855 | -11.480066 | -11.239828 | -12.733120 | -10.402049 | -12.239745 | -9.462955 | -10.720840 | -13.287712 | -13.287712 |
| Streptococcus salivarius | -8.101447 | -13.28771 | -8.031740 | -13.28771 | -6.027606 | -13.287712 | -5.216751 | -9.990480 | -4.794457 | -6.271805 | ⋯ | -5.765467 | -8.787154 | -6.677531 | -9.332870 | -6.390139 | -5.956515 | -6.171271 | -7.843794 | -13.287712 | -13.107588 |
| Streptococcus mitis | -8.640313 | -13.28771 | -6.970792 | -13.28771 | -8.923489 | -13.287712 | -8.574912 | -11.011312 | -7.707027 | -6.030782 | ⋯ | -7.413416 | -7.888510 | -8.354856 | -10.623496 | -5.996077 | -8.058582 | -9.147896 | -10.003570 | -9.926631 | -14.462431 |
| Streptococcus intermedius | -8.844672 | -13.28771 | -12.449668 | -13.28771 | -13.700157 | -13.287712 | -13.604019 | -15.416745 | -11.760309 | -13.108442 | ⋯ | -14.116743 | -9.965951 | -14.010708 | -15.495621 | -12.057509 | -13.833194 | -13.910068 | -14.465979 | -13.287712 | -13.287712 |
| Streptococcus vestibularis | -9.649415 | -13.28771 | -12.271631 | -13.28771 | -13.031779 | -13.287712 | -11.718190 | -16.321167 | -12.223281 | -11.758280 | ⋯ | -13.642812 | -15.257238 | -12.883427 | -15.444995 | -14.237630 | -15.038664 | -13.122119 | -14.708180 | -13.287712 | -13.287712 |
| Streptococcus parasanguinis | -9.865733 | -13.28771 | -6.499993 | -13.28771 | -6.610045 | -13.287712 | -5.935288 | -10.732357 | -6.192241 | -10.485956 | ⋯ | -8.057249 | -8.967286 | -6.446170 | -7.406076 | -9.405278 | -9.918664 | -7.444047 | -7.662494 | -13.287712 | -13.287712 |
| Streptococcus gordonii | -10.070553 | -13.28771 | -11.009548 | -13.28771 | -12.298059 | -13.287712 | -11.455156 | -15.197179 | -11.820972 | -10.177798 | ⋯ | -11.187320 | -13.446900 | -11.514814 | -13.055048 | -12.044026 | -13.576558 | -11.089430 | -11.529662 | -13.287712 | -13.287712 |
| Streptococcus pneumoniae | -10.560879 | -13.28771 | -7.645700 | -13.28771 | -8.936708 | -13.287712 | -7.707621 | -9.596042 | -8.889316 | -6.747209 | ⋯ | -6.460120 | -7.302705 | -9.342959 | -8.631435 | -6.953211 | -6.634478 | -9.273287 | -9.547333 | -13.287712 | -14.407983 |
| Streptococcus mutans | -11.309340 | -13.28771 | -13.462645 | -13.28771 | -15.807072 | -13.287712 | -13.287712 | -13.287712 | -15.667200 | -14.632004 | ⋯ | -16.038741 | -16.278300 | -14.112246 | -15.910658 | -13.909575 | -14.898486 | -11.264138 | -13.165190 | -13.287712 | -13.287712 |
| Streptococcus infantis | -11.429634 | -13.28771 | -8.184840 | -13.28771 | -8.534532 | -13.287712 | -8.080457 | -11.823571 | -9.516258 | -9.646938 | ⋯ | -10.752365 | -11.775176 | -10.459999 | -11.612978 | -9.133114 | -11.074057 | -10.332911 | -11.086207 | -13.287712 | -13.287712 |
| Streptococcus gwangjuense | -11.493764 | -13.28771 | -10.670267 | -13.28771 | -12.588649 | -13.287712 | -12.320226 | -14.825210 | -11.471574 | -10.013952 | ⋯ | -11.445890 | -11.679262 | -11.955742 | -14.325696 | -9.868891 | -11.801624 | -13.110146 | -13.526240 | -13.287712 | -13.287712 |
| Streptococcus pseudopneumoniae | -12.145841 | -13.28771 | -10.871901 | -13.28771 | -11.068720 | -13.287712 | -10.870193 | -14.436645 | -11.242910 | -9.733334 | ⋯ | -11.490629 | -10.580310 | -10.419921 | -12.827242 | -9.616045 | -11.243982 | -12.074813 | -12.536532 | -13.287712 | -13.287712 |
| Dolosigranulum pigrum | -6.936388 | -13.28771 | -16.837685 | -13.28771 | -13.287712 | -5.054401 | -13.287712 | -13.287712 | -16.754662 | -16.336548 | ⋯ | -17.286668 | -19.780800 | -17.237777 | -15.843544 | -13.287712 | -17.331445 | -13.287712 | -17.340448 | -3.507962 | -2.143709 |
| Granulicatella adiacens | -11.560879 | -13.28771 | -8.095586 | -13.28771 | -8.781294 | -13.287712 | -8.280524 | -11.067411 | -9.625379 | -8.294179 | ⋯ | -9.380905 | -9.657110 | -8.994603 | -9.199032 | -11.647560 | -11.361052 | -10.036779 | -10.504187 | -13.287712 | -13.287712 |
| Ligilactobacillus salivarius | -9.133017 | -13.28771 | -13.287712 | -13.28771 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -17.947308 | -15.258545 | ⋯ | -17.964740 | -17.906331 | -13.790318 | -15.718013 | -13.287712 | -13.287712 | -15.781082 | -16.546899 | -13.287712 | -13.287712 |
| Limosilactobacillus portuensis | -10.120306 | -13.28771 | -13.287712 | -13.28771 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | ⋯ | -21.286668 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 |
| Limosilactobacillus fermentum | -12.145841 | -13.28771 | -13.287712 | -13.28771 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | ⋯ | -17.479313 | -17.906331 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 |
| Lactobacillus gasseri | -10.908802 | -13.28771 | -13.287712 | -13.28771 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -16.947308 | -16.506473 | ⋯ | -21.286668 | -21.365763 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 |
| Lactobacillus crispatus | -12.252756 | -13.28771 | -13.287712 | -13.28771 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -18.432734 | -17.921510 | ⋯ | -18.701706 | -19.780800 | -16.790318 | -13.876711 | -13.287712 | -15.699177 | -13.287712 | -13.287712 | -13.287712 | -13.287712 |
| Enterococcus cecorum | -10.368234 | -13.28771 | -13.287712 | -13.28771 | -15.337587 | -11.692563 | -13.287712 | -13.287712 | -17.584737 | -16.091435 | ⋯ | -16.964740 | -19.365763 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 |
| Staphylococcus epidermidis | -10.429634 | -13.24857 | -13.287712 | -13.28771 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -17.295231 | -17.091435 | ⋯ | -17.701706 | -18.195838 | -13.287712 | -13.659120 | -13.287712 | -12.795392 | -14.328570 | -12.443208 | -13.287712 | -16.577908 |
| Veillonella parvula | -8.016558 | -13.28771 | -8.563307 | -13.28771 | -10.224424 | -13.287712 | -9.828373 | -7.832503 | -8.861740 | -8.551307 | ⋯ | -6.074970 | -6.283489 | -7.572279 | -6.700277 | -9.730172 | -7.439510 | -9.145221 | -8.694430 | -13.287712 | -12.323667 |
| Veillonella atypica | -9.120306 | -13.28771 | -6.992881 | -13.28771 | -5.673436 | -13.287712 | -5.325469 | -8.102371 | -5.907409 | -7.578818 | ⋯ | -5.699125 | -4.303738 | -4.497881 | -6.462690 | -6.158655 | -6.120531 | -5.916244 | -6.406905 | -13.287712 | -13.287712 |
| Veillonella nakazawae | -8.773287 | -13.28771 | -7.990823 | -13.28771 | -9.171006 | -13.287712 | -8.690870 | -8.823776 | -8.376368 | -9.213768 | ⋯ | -7.616012 | -8.039755 | -6.396141 | -7.212698 | -8.228545 | -7.174730 | -7.847547 | -6.833314 | -13.287712 | -13.287712 |
| Veillonella dispar | -9.493764 | -13.28771 | -6.493458 | -13.28771 | -10.215190 | -13.287712 | -9.676370 | -7.903856 | -9.467527 | -9.753813 | ⋯ | -9.531363 | -9.533268 | -7.535447 | -8.814131 | -9.254029 | -9.273995 | -9.466290 | -8.890612 | -13.287712 | -13.287712 |
| Veillonella sp. S12025-13 | -9.631268 | -13.28771 | -7.841211 | -13.28771 | -9.396376 | -13.287712 | -8.898763 | -8.839834 | -9.188133 | -9.717483 | ⋯ | -8.627564 | -7.511674 | -7.139984 | -8.027724 | -8.404201 | -7.732090 | -8.757838 | -7.860668 | -13.287712 | -13.287712 |
| ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋱ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ | ⋮ |
| Prevotella intermedia | -11.145841 | -13.287712 | -9.332866 | -13.287712 | -9.293193 | -13.287712 | -8.950162 | -8.702311 | -8.028231 | -8.168665 | ⋯ | -6.842365 | -7.359261 | -13.814565 | -14.495621 | -8.473111 | -7.542727 | -9.745921 | -9.570060 | -13.287712 | -13.28771 |
| Prevotella jejuni | -11.631268 | -13.287712 | -7.550550 | -13.287712 | -4.708332 | -13.287712 | -4.391391 | -6.342494 | -6.103218 | -8.626890 | ⋯ | -5.006967 | -6.273171 | -9.748111 | -10.646551 | -4.557139 | -4.932408 | -7.988720 | -8.601230 | -13.287712 | -13.28771 |
| Porphyromonas gingivalis | -9.686410 | -13.287712 | -9.551705 | -13.287712 | -12.541728 | -13.287712 | -12.735264 | -9.396507 | -11.343151 | -11.029389 | ⋯ | -12.864604 | -9.840731 | -17.112246 | -13.287712 | -8.732874 | -11.707930 | -5.855996 | -6.264123 | -13.287712 | -13.28771 |
| Tannerella forsythia | -10.526931 | -13.287712 | -11.611273 | -13.287712 | -11.786413 | -13.287712 | -11.346222 | -12.184505 | -10.411477 | -12.088620 | ⋯ | -9.259108 | -12.233906 | -14.430422 | -16.602536 | -10.483879 | -12.681830 | -9.539663 | -9.706242 | -13.287712 | -13.28771 |
| Capnocytophaga gingivalis | -11.953196 | -13.287712 | -12.017506 | -13.287712 | -14.337587 | -13.287712 | -13.879654 | -8.702688 | -10.553764 | -8.990773 | ⋯ | -6.597708 | -11.852035 | -15.609746 | -14.981048 | -12.382827 | -10.522803 | -14.899726 | -15.632629 | -13.287712 | -14.38151 |
| Capnocytophaga leadbetteri | -12.368234 | -13.287712 | -16.193829 | -13.287712 | -13.922550 | -13.287712 | -13.604019 | -13.257842 | -12.103611 | -7.852284 | ⋯ | -7.779865 | -12.158749 | -13.287712 | -13.287712 | -14.622293 | -15.746483 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Fusobacterium nucleatum | -10.953196 | -13.287712 | -10.607664 | -13.287712 | -10.510333 | -13.287712 | -10.077733 | -8.781213 | -9.727448 | -10.072540 | ⋯ | -6.659647 | -9.183989 | -13.708524 | -15.215513 | -10.276519 | -9.512544 | -9.743607 | -8.734598 | -13.287712 | -12.93405 |
| Treponema denticola | -11.783271 | -13.287712 | -12.566222 | -13.287712 | -13.398988 | -13.287712 | -13.879654 | -13.693680 | -13.207768 | -11.869848 | ⋯ | -12.628457 | -13.089638 | -15.839228 | -13.287712 | -11.928032 | -14.463549 | -14.920485 | -14.999411 | -13.287712 | -13.28771 |
| Homo sapiens | -8.543805 | -8.619849 | -11.106366 | -8.624113 | -10.524518 | -9.078745 | -11.061492 | -13.535107 | -11.713003 | -11.803723 | ⋯ | -13.199205 | -13.577860 | -11.089878 | -12.138069 | -10.612309 | -10.790736 | -12.738991 | -12.505872 | -8.595425 | -12.74502 |
| Aspergillus fumigatus | -11.705269 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | ⋯ | -20.286668 | -21.365763 | -13.287712 | -16.055048 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Human gammaherpesvirus 4 | -12.368234 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | ⋯ | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Vibrio kanaloae | -13.287712 | -6.955950 | -8.549973 | -13.287712 | -7.953403 | -13.287712 | -10.520251 | -13.287712 | -11.160338 | -14.025346 | ⋯ | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -9.099603 | -13.287712 | -13.790605 | -13.287712 | -6.686070 | -13.28771 |
| Vibrio plantisponsor | -13.287712 | -8.240753 | -9.782402 | -13.287712 | -9.294408 | -13.287712 | -11.588422 | -13.287712 | -12.441779 | -16.003973 | ⋯ | -13.287712 | -21.365763 | -14.254265 | -13.287712 | -10.472546 | -13.287712 | -15.356584 | -13.287712 | -8.047937 | -13.28771 |
| Vibrio toranzoniae | -13.287712 | -11.187172 | -13.179473 | -13.287712 | -12.612694 | -13.287712 | -13.287712 | -13.287712 | -15.469260 | -17.769507 | ⋯ | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -14.091779 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Vibrio diabolicus | -13.287712 | -12.017247 | -14.411420 | -13.287712 | -13.259585 | -13.287712 | -13.287712 | -13.287712 | -16.947308 | -13.287712 | ⋯ | -20.286668 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Vibrio alginolyticus | -13.287712 | -11.865244 | -13.930794 | -13.287712 | -12.553316 | -13.287712 | -13.287712 | -13.287712 | -15.625379 | -13.287712 | ⋯ | -19.286668 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Vibrio cholerae | -13.287712 | -11.602209 | -13.488957 | -13.287712 | -13.167662 | -13.287712 | -13.287712 | -15.991860 | -15.710268 | -17.390996 | ⋯ | -17.038741 | -14.117835 | -13.287712 | -13.287712 | -13.488438 | -15.129811 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Vibrio ziniensis | -13.287712 | -13.379817 | -14.361951 | -13.287712 | -13.726152 | -13.287712 | -13.287712 | -13.287712 | -16.362345 | -13.287712 | ⋯ | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -15.792218 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Vibrio crassostreae | -13.287712 | -13.187172 | -15.030330 | -13.287712 | -14.752625 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | ⋯ | -21.286668 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Vibrio celticus | -13.287712 | -13.248572 | -16.252722 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -17.947308 | -13.287712 | ⋯ | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Vibrio cyclitrophicus | -13.287712 | -13.602209 | -15.708402 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | ⋯ | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Pseudoalteromonas prydzensis | -13.287712 | -7.880350 | -9.568558 | -13.287712 | -8.914121 | -13.287712 | -11.294691 | -13.287712 | -11.906040 | -14.806033 | ⋯ | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -10.039002 | -13.287712 | -14.879262 | -13.287712 | -7.479948 | -13.28771 |
| Pseudoalteromonas rhizosphaerae | -13.287712 | -9.617316 | -11.396816 | -13.287712 | -10.752625 | -13.287712 | -13.604019 | -13.287712 | -13.847772 | -15.632004 | ⋯ | -13.287712 | -21.365763 | -13.287712 | -13.287712 | -11.915701 | -13.287712 | -16.859084 | -13.287712 | -9.751544 | -13.28771 |
| Pseudoalteromonas sp. KAN5 | -13.287712 | -11.663610 | -13.708402 | -13.287712 | -13.115195 | -13.287712 | -13.287712 | -13.287712 | -15.545209 | -13.287712 | ⋯ | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.563400 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Pseudoalteromonas mariniglutinosa | -13.287712 | -10.674102 | -13.260256 | -13.287712 | -12.409480 | -13.287712 | -13.287712 | -13.287712 | -15.754662 | -13.287712 | ⋯ | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.050751 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Idiomarina loihiensis | -13.287712 | -12.817938 | -14.345832 | -13.287712 | -13.952923 | -13.287712 | -13.287712 | -13.287712 | -17.169700 | -13.287712 | ⋯ | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -14.934237 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Pseudomonas aeruginosa | -13.287712 | -10.128278 | -12.760869 | -13.287712 | -13.287712 | -6.977069 | -13.287712 | -14.865103 | -15.710268 | -14.521580 | ⋯ | -19.701706 | -16.558408 | -13.631119 | -9.476427 | -12.192306 | -12.005915 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Pseudomonas sessilinigenes | -13.287712 | -10.841397 | -13.497835 | -13.287712 | -12.388571 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | ⋯ | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -12.838022 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Pseudomonas putida | -13.287712 | -12.865244 | -13.942867 | -13.287712 | -13.576775 | -13.287712 | -13.287712 | -15.773680 | -15.800466 | -14.665171 | ⋯ | -17.964740 | -16.195838 | -9.516678 | -11.033849 | -13.934237 | -13.687589 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
| Acinetobacter sp. TTH0-4 | -13.287712 | -12.017247 | -15.004795 | -13.287712 | -14.378229 | -13.287712 | -13.287712 | -13.287712 | -18.432734 | -13.287712 | ⋯ | -21.286668 | -13.287712 | -13.287712 | -13.287712 | -14.934237 | -13.287712 | -13.287712 | -13.287712 | -13.287712 | -13.28771 |
options(repr.plot.width=20, repr.plot.height=15)
abun_wild_taxon %>%
column_to_rownames(var="taxon_name") %>%
head(100) %>% mutate_if(is.numeric, ~ifelse(abs(.) == 0,0.0001,.)) %>%
mutate_if(is_double,log2)%>%
heatmaply(
k_col = 2, k_row = 2, xlab="Samples", ylab="taxa",grid_gap=.1,
colors=colorRampPalette(c('white','orange','red'))(50),
main="Oral microbiome diversity in COVID+/- patients",
key.title='Abundance',
plot_method='plotly') %>%
layout(height=1000, width=1000)
Warning message: “Specifying width/height in layout() is now deprecated. Please specify in ggplotly() or plot_ly()”